ID: 948015103

View in Genome Browser
Species Human (GRCh38)
Location 2:234682670-234682692
Sequence AGTGAAGGCAGACCACAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 312
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 286}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948015099_948015103 10 Left 948015099 2:234682637-234682659 CCAGAGAGGCCAGTTGGGGCATG No data
Right 948015103 2:234682670-234682692 AGTGAAGGCAGACCACAGGCTGG 0: 1
1: 0
2: 2
3: 23
4: 286
948015094_948015103 20 Left 948015094 2:234682627-234682649 CCTCCTGGGACCAGAGAGGCCAG No data
Right 948015103 2:234682670-234682692 AGTGAAGGCAGACCACAGGCTGG 0: 1
1: 0
2: 2
3: 23
4: 286
948015093_948015103 21 Left 948015093 2:234682626-234682648 CCCTCCTGGGACCAGAGAGGCCA No data
Right 948015103 2:234682670-234682692 AGTGAAGGCAGACCACAGGCTGG 0: 1
1: 0
2: 2
3: 23
4: 286
948015100_948015103 1 Left 948015100 2:234682646-234682668 CCAGTTGGGGCATGTTCTTTTCA No data
Right 948015103 2:234682670-234682692 AGTGAAGGCAGACCACAGGCTGG 0: 1
1: 0
2: 2
3: 23
4: 286
948015095_948015103 17 Left 948015095 2:234682630-234682652 CCTGGGACCAGAGAGGCCAGTTG No data
Right 948015103 2:234682670-234682692 AGTGAAGGCAGACCACAGGCTGG 0: 1
1: 0
2: 2
3: 23
4: 286

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948015103 Original CRISPR AGTGAAGGCAGACCACAGGC TGG Intergenic