ID: 948015103

View in Genome Browser
Species Human (GRCh38)
Location 2:234682670-234682692
Sequence AGTGAAGGCAGACCACAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 312
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 286}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948015093_948015103 21 Left 948015093 2:234682626-234682648 CCCTCCTGGGACCAGAGAGGCCA No data
Right 948015103 2:234682670-234682692 AGTGAAGGCAGACCACAGGCTGG 0: 1
1: 0
2: 2
3: 23
4: 286
948015095_948015103 17 Left 948015095 2:234682630-234682652 CCTGGGACCAGAGAGGCCAGTTG No data
Right 948015103 2:234682670-234682692 AGTGAAGGCAGACCACAGGCTGG 0: 1
1: 0
2: 2
3: 23
4: 286
948015100_948015103 1 Left 948015100 2:234682646-234682668 CCAGTTGGGGCATGTTCTTTTCA No data
Right 948015103 2:234682670-234682692 AGTGAAGGCAGACCACAGGCTGG 0: 1
1: 0
2: 2
3: 23
4: 286
948015094_948015103 20 Left 948015094 2:234682627-234682649 CCTCCTGGGACCAGAGAGGCCAG No data
Right 948015103 2:234682670-234682692 AGTGAAGGCAGACCACAGGCTGG 0: 1
1: 0
2: 2
3: 23
4: 286
948015099_948015103 10 Left 948015099 2:234682637-234682659 CCAGAGAGGCCAGTTGGGGCATG No data
Right 948015103 2:234682670-234682692 AGTGAAGGCAGACCACAGGCTGG 0: 1
1: 0
2: 2
3: 23
4: 286

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948015103 Original CRISPR AGTGAAGGCAGACCACAGGC TGG Intergenic
900107149 1:987644-987666 AGAAAAGACAAACCACAGGCTGG - Intergenic
900541033 1:3202881-3202903 AGAGTACTCAGACCACAGGCTGG - Intronic
900679053 1:3906252-3906274 ACTGCAGGCAGTGCACAGGCAGG + Intergenic
900763918 1:4491237-4491259 AGTGAGGTCAGGACACAGGCAGG - Intergenic
902724615 1:18326367-18326389 AGGGAGGGCAGAGCCCAGGCAGG + Intronic
903288569 1:22292568-22292590 AGTGGTGGCAGAGCTCAGGCTGG - Intergenic
904048728 1:27625260-27625282 AGTGAAGGCAGAAGTCATGCTGG - Intronic
904438378 1:30514009-30514031 AGGGCAGGCAGAGCCCAGGCTGG - Intergenic
904488953 1:30846561-30846583 GGAGAAGGCAGACCCCGGGCTGG + Intergenic
904876074 1:33655530-33655552 GGTGAAGGCAGACCTGAGCCAGG + Intronic
904948802 1:34219215-34219237 CATGAAAGGAGACCACAGGCTGG + Intergenic
905237845 1:36562345-36562367 AGTGACGGCTGCCCCCAGGCGGG - Intergenic
905392233 1:37644164-37644186 AGTGGAGGCAGATGACAGGGAGG - Intergenic
905484296 1:38284641-38284663 AGGAAAGGCAGACCAGAGGTCGG + Intergenic
905771344 1:40640000-40640022 AGTCAAGGCAGACCACTAGAAGG + Intronic
907797570 1:57732729-57732751 AGTGAAGGTAGAAAGCAGGCAGG + Intronic
909398121 1:75193669-75193691 AGTTAAGGCAAAACACAGGTTGG - Intergenic
913451607 1:118996610-118996632 AGAGAAGGCTGACCAAGGGCTGG - Intergenic
914341152 1:146761712-146761734 AGAGAAGGAAGACCTCAGCCTGG - Intergenic
915345998 1:155197257-155197279 AGTGAGGGGAGACAACAGGTCGG + Intronic
915748046 1:158180391-158180413 AGGGAAGACAGAGCAGAGGCCGG + Intronic
916175799 1:162037228-162037250 AATGAAGGCAGCCACCAGGCTGG + Intergenic
916717226 1:167455841-167455863 ACCGAAGGCAGGCCCCAGGCCGG - Intronic
918045679 1:180939610-180939632 AGTGAAGGCAGAGAGCAGGTAGG - Intronic
919951590 1:202369126-202369148 CGTGAACGCAGAACACAGGTGGG + Intronic
920553610 1:206886497-206886519 ATAGAAGGCAGAGCACAGGTGGG - Intergenic
922412448 1:225389708-225389730 GTGGAAGGCAGACCACAGGTTGG - Intronic
923500544 1:234560253-234560275 TCTGAAGGCAGACCTCAAGCTGG + Intergenic
923758933 1:236821501-236821523 TGAGAAGACAAACCACAGGCTGG - Intronic
1063255001 10:4317528-4317550 AGTGAAGTCAGGATACAGGCTGG - Intergenic
1067184924 10:44019028-44019050 AATGAAGACAGACCACAATCTGG + Intergenic
1067827384 10:49587424-49587446 AGTGAAGACAGTCCACAGAAGGG + Intergenic
1069186070 10:65424863-65424885 ATTGAATGCAAACCACAGGTTGG + Intergenic
1069856502 10:71443844-71443866 AGAGCAGGCCCACCACAGGCGGG - Intronic
1070554351 10:77516423-77516445 AGTGGAGACAGACCACAGACAGG - Intronic
1072424723 10:95320355-95320377 AGTGAAGGAAGAGCCCAGGAAGG - Intronic
1074708629 10:116158567-116158589 AGTAAGGCCAGACCACAGGAAGG + Intronic
1074805632 10:117048479-117048501 AATGAAGGCAGACCACTGATTGG + Intronic
1075702899 10:124480808-124480830 AGTGAATGCAGACCAGAGGCTGG - Intronic
1076720581 10:132390856-132390878 TGTGAAGGGAGACCCCAGCCTGG + Intergenic
1076753591 10:132556082-132556104 AAGGAAGGGAGCCCACAGGCTGG - Intronic
1077170149 11:1162473-1162495 AGTGAGGAGAGACCCCAGGCAGG - Intronic
1078448664 11:11424228-11424250 AGGGAGGGCAGACCAGAGCCAGG - Intronic
1078667647 11:13339756-13339778 GGAGGAGGCAGACCACAGGAGGG - Intronic
1078823730 11:14906993-14907015 AGCCAAGGCAGACTACAGGAGGG + Intronic
1079466941 11:20740103-20740125 ATTGAGTGCAGACCACATGCTGG + Intronic
1080601623 11:33826441-33826463 AGAGAAGTCAGCACACAGGCAGG - Intergenic
1081027575 11:38035023-38035045 AGTGAAGTCGGAGGACAGGCAGG + Intergenic
1081260526 11:40954706-40954728 AGTGATCCCAGACCACTGGCAGG + Intronic
1081993662 11:47350595-47350617 AGAGAAGGCAGAGCCCATGCTGG - Exonic
1082087003 11:48058507-48058529 AGTCAAGGAAGACCCAAGGCTGG - Intronic
1083326109 11:61873796-61873818 AGTGAAGGCAACACCCAGGCGGG - Exonic
1084433289 11:69123328-69123350 AGTGAAGGAAGTGCTCAGGCTGG + Intergenic
1084468262 11:69339973-69339995 AGTAAAGGCAGACCTGAGACTGG + Intronic
1086213879 11:84353753-84353775 AGAGAAGACAGAACACAGTCAGG - Intronic
1088894538 11:114067830-114067852 AGTGAGGGCTGAGCACACGCAGG - Intronic
1089699994 11:120239006-120239028 AGTGAAGGCACACGAAATGCTGG + Intronic
1090627774 11:128620945-128620967 AGTGAAACCAGAACCCAGGCTGG - Intergenic
1090890217 11:130916442-130916464 TGTGAAGGCTGACCGCCGGCCGG + Exonic
1091098569 11:132847579-132847601 AGGGAAGGGAGAGCAAAGGCAGG + Intronic
1091331070 11:134731265-134731287 AGAGAAGCCAGACCCCAGGGAGG - Intergenic
1092124484 12:6065786-6065808 AGAGTAGGCAGCCCAGAGGCAGG + Intronic
1095495565 12:42780211-42780233 AGGGAAGGCAGACAACAGGGTGG + Intergenic
1095649024 12:44584773-44584795 GGTGAAGGCAGATGACAGACTGG + Intronic
1096619868 12:52857525-52857547 AGGGGAGGCTGACCAAAGGCAGG - Intergenic
1097160920 12:57046261-57046283 AGGGAAAGCAGAACCCAGGCAGG + Intronic
1097318760 12:58202306-58202328 ATTGAAGGCAAACCAGAGGAAGG - Intergenic
1098187858 12:67916965-67916987 AGGGAAGGCAGAAGAAAGGCAGG - Intergenic
1098346445 12:69509350-69509372 AGTGAAGACAAAACACAGGATGG - Intronic
1101365060 12:104063854-104063876 AGTGAGGGCTGTCCACAGCCTGG - Intronic
1101769177 12:107732641-107732663 AGTAAAGGCATACCTTAGGCAGG + Intergenic
1104085538 12:125471137-125471159 AGTGAATGCAGCAGACAGGCTGG - Intronic
1104259813 12:127172143-127172165 AGTGTGGGCAGAACACAGTCAGG + Intergenic
1104542594 12:129681132-129681154 ATTGAAGACAGACCACCAGCTGG + Intronic
1105840018 13:24246176-24246198 AGTACAAGAAGACCACAGGCAGG - Intronic
1106002136 13:25734120-25734142 ATTGAATGCAGACCATATGCTGG - Intronic
1106468892 13:30037474-30037496 AGGGAAGGGGGACCCCAGGCGGG - Intergenic
1110226288 13:73122916-73122938 AAAGAATGCAGACCAAAGGCCGG - Intergenic
1113336248 13:109378845-109378867 AGTGATGGCAGAACAGAGGCTGG + Intergenic
1117846963 14:59921372-59921394 AGGGAAGACAGACTACAGGGAGG + Intronic
1119646301 14:76350935-76350957 AGGCAAGGCAGACAGCAGGCAGG - Intronic
1120063943 14:80017911-80017933 AGTGAAGACAGATCAATGGCAGG + Intergenic
1122396445 14:101436038-101436060 AGGGCAGCCAGACCAGAGGCAGG - Intergenic
1123480121 15:20623274-20623296 GGTGCAGGCAGGGCACAGGCAGG + Intergenic
1123637886 15:22377090-22377112 GGTGCAGGCAGGGCACAGGCAGG - Intergenic
1124627173 15:31314794-31314816 GGTGAGTACAGACCACAGGCAGG + Intergenic
1124627959 15:31320172-31320194 GGTGAGTACAGACCACAGGCAGG + Intergenic
1125729023 15:41882496-41882518 AGTGAAGGCAGAACAGGGGAGGG + Intronic
1126257019 15:46639911-46639933 GGTGAAGGCAGAGCACACGGGGG + Intergenic
1127959760 15:63882106-63882128 ACTGAAGGCAGAACACAGCAAGG + Intergenic
1128800918 15:70496347-70496369 ACTGAAGCCAGACCACAGTGTGG + Intergenic
1131222259 15:90594802-90594824 AGGGAGGGGAGAGCACAGGCTGG - Intronic
1131683178 15:94745003-94745025 AGGGAGGGAAGAACACAGGCAGG + Intergenic
1133102267 16:3486555-3486577 AATGAAGGCAGGCACCAGGCAGG + Exonic
1133165959 16:3947338-3947360 AGGGAAGGCAGAGCACACTCAGG - Intergenic
1134293577 16:12924082-12924104 ACTGAAGCCAGACCACTGACTGG - Intronic
1136023150 16:27452792-27452814 AATGAAGGCACAGCTCAGGCTGG + Intergenic
1136036881 16:27547305-27547327 AGTGAAAGCAGGCCAGAGGGAGG - Intronic
1136485563 16:30569945-30569967 AGTGCCGGAAGAGCACAGGCGGG + Exonic
1136753481 16:32664131-32664153 AATACAGGCAGGCCACAGGCGGG + Intergenic
1136814632 16:33206234-33206256 AATACAGGCAGGCCACAGGCGGG - Intronic
1136821108 16:33316314-33316336 AATACAGGCAGGCCACAGGCGGG - Intergenic
1136827671 16:33372853-33372875 AATACAGGCAGGCCACAGGCGGG - Intergenic
1136832737 16:33471624-33471646 AATACAGGCAGGCCACAGGCGGG - Intergenic
1137015461 16:35369749-35369771 ACTGGAGGCAGGACACAGGCAGG + Intergenic
1137021094 16:35428325-35428347 ACTGGAGGCAGGGCACAGGCAGG + Intergenic
1137027744 16:35495317-35495339 ACTGGAGGCAGGGCACAGGCAGG + Intergenic
1137028031 16:35498081-35498103 AGTGCAGGCAGGGCACAGGCAGG + Intergenic
1137034294 16:35556187-35556209 AGTGGAGGCAGAGTACAGGTGGG + Intergenic
1137035104 16:35563475-35563497 TGTGAATGCAGTCCACAGGTTGG - Intergenic
1137035592 16:35566950-35566972 ACTGTAGGCAGGGCACAGGCAGG + Intergenic
1138268874 16:55680541-55680563 AGTGAAGCCAGAACAAAAGCAGG - Intronic
1138291389 16:55850170-55850192 TGAGAAGGCAGACCACAGACTGG - Intronic
1139993133 16:70955696-70955718 AGAGAAGGAAGACCTCAGCCTGG + Intronic
1140378392 16:74463983-74464005 TGTTAAGGGTGACCACAGGCTGG - Intronic
1141704560 16:85657569-85657591 GGCGGAGGCAGAGCACAGGCCGG + Exonic
1142392536 16:89811625-89811647 ATTGAATGCAGACCAGTGGCTGG - Intronic
1202993208 16_KI270728v1_random:29208-29230 AATACAGGCAGGCCACAGGCGGG - Intergenic
1142731331 17:1860256-1860278 AGTCCAGGCAGTCCACAGGCAGG - Intronic
1142758283 17:2028540-2028562 AGCTAAGGCTGTCCACAGGCTGG + Intergenic
1145109785 17:20152382-20152404 TGTGCAGGCAGACCAAAGGGGGG + Intronic
1147213167 17:38883948-38883970 TGGGAAGGCTGCCCACAGGCGGG - Intronic
1147635148 17:41959463-41959485 AGTGCCTGCAGACCCCAGGCTGG - Intronic
1148122987 17:45223167-45223189 AGGGAAGGCTGACAGCAGGCAGG - Intronic
1148235192 17:45964053-45964075 CGTGATGGCTGACCTCAGGCAGG - Intronic
1148586848 17:48787151-48787173 AGAGAAGGCAGAGCAGAGGAGGG - Intronic
1148785240 17:50143069-50143091 TGTGAAGGCATACAACAGGAGGG - Intronic
1151758856 17:76089516-76089538 AATGAAGCCAGAACAAAGGCTGG - Intronic
1151968543 17:77445088-77445110 AGTGAAGGCCGTCCCCAGGCAGG - Intronic
1152684887 17:81689045-81689067 AGTGATGGCAGACAACACACAGG + Intronic
1152779712 17:82221191-82221213 AGTGAAGGCAGCCCACAGAATGG + Intergenic
1155706610 18:28823694-28823716 AGTGGTGGCGGACCCCAGGCAGG + Intergenic
1156537212 18:37875562-37875584 TGTGCAGGCAGAACTCAGGCTGG - Intergenic
1157270535 18:46272397-46272419 TGTGAAGGCAGAAAACATGCTGG + Intergenic
1157283395 18:46360697-46360719 GGTGAAGGCAGGCCAGGGGCAGG - Intronic
1158372511 18:56824985-56825007 AGCCAAGGCAGACCACAGAAAGG - Intronic
1159144991 18:64442606-64442628 ATTGAACGCAGACCCCAGGGAGG - Intergenic
1161587426 19:5113224-5113246 GGTGAAGGCAGCCCCCAGGATGG - Intronic
1161658385 19:5530104-5530126 AGTGAGGCCACACCCCAGGCAGG + Intergenic
1161895158 19:7074707-7074729 GGTCAAGGCAGATCACAGGCTGG + Intronic
1163987566 19:20967978-20968000 TGTGTAGGCAGTGCACAGGCAGG - Intergenic
1164086568 19:21907975-21907997 CATGAGGGCAGACCACAAGCAGG - Intergenic
1164204346 19:23045392-23045414 CATGAAGGCAGGGCACAGGCAGG + Intergenic
1164687679 19:30178924-30178946 AGTGAAGGCTGAGAACAGGCTGG + Intergenic
1164860435 19:31558344-31558366 AGTAAAGGGAGAGCACAGCCAGG + Intergenic
1165204271 19:34170734-34170756 GATGAAGGCAGAGCACAGGCAGG - Intergenic
1167000379 19:46742283-46742305 AGAGAAGGCAGCCCCCAGGGAGG - Intronic
1167981255 19:53277555-53277577 AGGGAAGGAAGACAACAGGTTGG + Intergenic
925182175 2:1824460-1824482 AGAGAAGGCTGAGCACAGGGAGG + Intronic
926041015 2:9673225-9673247 AGAGAAGACAAGCCACAGGCTGG - Intergenic
926613388 2:14970559-14970581 GGAGTAGGCAGACCTCAGGCAGG + Intergenic
928040625 2:27872920-27872942 AGTAAAGGCAAAACACTGGCAGG + Intronic
929444743 2:41992895-41992917 ATTGAAGGCTGACCCCAGGCAGG - Intergenic
932127494 2:69157109-69157131 AGTGAATGGAGACCACTGGCTGG - Intronic
934059619 2:88282060-88282082 AGAGAAGGCAGAACACAGGCTGG + Intergenic
935691685 2:105737611-105737633 AGGCAATGCAGACCACAGACAGG + Intergenic
936271197 2:111050554-111050576 AGGGAAGAAAGACCAAAGGCCGG - Intronic
937992473 2:127672356-127672378 AGTGAAGGCAGCCCAGAGCATGG - Intronic
938239303 2:129730956-129730978 AGTGAAAACAGCCCACATGCAGG + Intergenic
938488799 2:131745568-131745590 AGGGAAGGCACACCACCAGCAGG - Intronic
938942000 2:136177602-136177624 ATTGAAGGCAGACAACAGATAGG - Intergenic
939005068 2:136777433-136777455 AGTGAGGGCAGAATACAGACTGG - Intronic
940450803 2:153834208-153834230 AGGGAAGCCCTACCACAGGCTGG + Intergenic
942184054 2:173407542-173407564 AGGGTAGCCAGCCCACAGGCTGG - Intergenic
942346301 2:175005665-175005687 AGTGAACGCAGCGCCCAGGCAGG + Intergenic
942365134 2:175218318-175218340 AGTGAAGACAGCCCACAGAATGG + Intergenic
948015103 2:234682670-234682692 AGTGAAGGCAGACCACAGGCTGG + Intergenic
948605982 2:239135402-239135424 AGTGACGGCAGAGCTCAGGAAGG + Intronic
1169272356 20:4210452-4210474 AATTAAGGTGGACCACAGGCAGG - Intergenic
1171233922 20:23509335-23509357 AGTGAGGTCAGAGCAGAGGCTGG + Intergenic
1171523913 20:25795202-25795224 AGGGAAGACAGAGCAGAGGCCGG + Intronic
1171552914 20:26060681-26060703 AGGGAAGACAGAGCAGAGGCCGG - Intergenic
1171756921 20:29119183-29119205 AGTGATTGCTGACCACATGCTGG + Intergenic
1172146414 20:32761621-32761643 CGTGGAGACAGACCACAAGCAGG + Intergenic
1172444125 20:34984422-34984444 AATGAAGGGAGGCCAGAGGCCGG + Intronic
1173725231 20:45292924-45292946 ACAGAAGGAAGGCCACAGGCTGG + Intergenic
1174056363 20:47800923-47800945 AGTGCAGGCAGCCCCCAAGCTGG + Intergenic
1174454601 20:50640352-50640374 AATGAAGGCAGGTCTCAGGCAGG - Intronic
1174472196 20:50769369-50769391 AATGAAGGCAGGTCTCAGGCAGG + Intergenic
1174949345 20:55027567-55027589 ATTGAAGACAGACCAAAGCCAGG - Intergenic
1175708127 20:61196400-61196422 AGTGGCAGCAGACCGCAGGCTGG + Intergenic
1176416413 21:6477867-6477889 AGAAAAGGCAAACCACAGACTGG + Intergenic
1178669866 21:34580899-34580921 AATCAAGGCAAAGCACAGGCAGG + Intronic
1179691913 21:43086202-43086224 AGAAAAGGCAAACCACAGACTGG + Intergenic
1181111527 22:20605613-20605635 AGGGAGGGCAGGACACAGGCAGG + Intergenic
1181658448 22:24320845-24320867 AGTGAAGGGAGATCATAGGTGGG - Intronic
1182604408 22:31492004-31492026 AGTGGGGGCAGCCCAAAGGCTGG + Intronic
1184067368 22:42128378-42128400 GGTGAACGCAGAGCACAGGAGGG - Intronic
1184070094 22:42142072-42142094 GGTGAACGCAGAGCACAGGAGGG - Intergenic
1184071836 22:42151678-42151700 GGTGAACGCAGAGCACAGGAGGG - Intergenic
1185027900 22:48425997-48426019 GGAGAAGGCAGAGCACAGACAGG + Intergenic
1185215317 22:49596173-49596195 AGAGAAGGCAGCTCATAGGCAGG + Intronic
1185258744 22:49850047-49850069 AATAAAGGGAAACCACAGGCAGG - Intergenic
1185320979 22:50200233-50200255 AATAAAGGGAAACCACAGGCAGG + Intergenic
950529162 3:13543197-13543219 AGCGAAGGCAGCCCAGAGACAGG - Intergenic
950676147 3:14555499-14555521 AGAGAAGGCAGAGCAGAGGCGGG + Intergenic
950900486 3:16493038-16493060 CGAGATGGCAGACAACAGGCAGG + Intronic
953794877 3:45976929-45976951 AGTGAAGGCAGGCAGCAGCCTGG + Intronic
954789563 3:53121607-53121629 TGTGAATGCAGACCACACGGCGG + Intronic
955441364 3:58958896-58958918 AATGAAGACAAACCACAGACTGG - Intronic
957684243 3:83479963-83479985 AGGGAAGGAAGACCACAGAGTGG + Intergenic
958038670 3:88200030-88200052 AATCAAGGAAGACAACAGGCTGG + Intergenic
960688051 3:120313715-120313737 AGTGGAGGGAGGGCACAGGCAGG - Intergenic
961353109 3:126316470-126316492 GGGGAAGGGAGTCCACAGGCCGG + Intergenic
961353160 3:126316651-126316673 AGGGAAGGGAGTGCACAGGCTGG + Intergenic
962930944 3:140035390-140035412 TGTGAAGGAAAAGCACAGGCAGG - Intronic
962979199 3:140472618-140472640 AATGAGGGCAGGGCACAGGCAGG - Intronic
963217635 3:142767396-142767418 TGAGAAGGCAAACCACAGACTGG - Intronic
963391040 3:144664676-144664698 AGTAAAGACATACCAGAGGCTGG + Intergenic
964853134 3:161116881-161116903 AGTGAAGACAGCCAACAGGATGG + Intronic
968272889 3:197418403-197418425 GGGGAAGGCAGTGCACAGGCAGG + Intergenic
968861659 4:3176321-3176343 ATTAAAAGCAGACCCCAGGCCGG - Intronic
969049637 4:4363592-4363614 AGTGTGGGCAGAGCACAGACTGG + Intronic
969272718 4:6113717-6113739 AGGGAAGGGAGAGCAGAGGCGGG - Intronic
969303396 4:6310554-6310576 AGTAAAGGCAGAGGCCAGGCTGG - Intergenic
971263642 4:25078766-25078788 TGTGAAGACATACCATAGGCTGG + Intergenic
972762946 4:42124648-42124670 AGTGAAGCCAGATTACAGGGTGG + Intronic
972820063 4:42691387-42691409 AATGAAAGCAGACCAGAAGCTGG + Intergenic
973096153 4:46202703-46202725 GGTGAAGGAAGAGCAAAGGCAGG + Intergenic
974640286 4:64621540-64621562 AATGAAATAAGACCACAGGCTGG - Intergenic
977964504 4:103128495-103128517 TGTGAAGACAGACCACATTCTGG + Intronic
978547006 4:109880612-109880634 TGTGAAGTGAGACCACTGGCTGG - Intergenic
983189119 4:164735698-164735720 AGTGAATGAAAATCACAGGCTGG - Intergenic
984316961 4:178140792-178140814 AGTGTAGGCAAACAACAGACTGG - Intergenic
984498819 4:180532757-180532779 GGTGAAGACAGAAGACAGGCAGG + Intergenic
986464967 5:8011929-8011951 AGTGAAGGCAGACCTCATGGAGG + Intergenic
986903670 5:12467921-12467943 AGTGGGGGCAGGGCACAGGCAGG - Intergenic
992497168 5:77305391-77305413 AGGGCAGCCAGACCACAGCCAGG + Intronic
992940058 5:81751888-81751910 AGAGGAGGCCGACCCCAGGCCGG - Intergenic
995798257 5:115963250-115963272 GGTGAAGGAAGACCTCAGGGAGG + Exonic
996217936 5:120891873-120891895 AGTGCAGGTACACCAAAGGCTGG - Intergenic
996596785 5:125212540-125212562 AGTGAAGGCCCACTAAAGGCTGG - Intergenic
997964950 5:138349464-138349486 AGTGAAGCCACTCCCCAGGCTGG + Exonic
998497197 5:142601216-142601238 AATGAAAGCAGAACACATGCAGG - Intronic
999834212 5:155352207-155352229 AGAGAATGCAGACCCCAGGCTGG + Intergenic
999837780 5:155392891-155392913 AGGGAAGGCAGAGGACAGGCAGG + Intergenic
1000516861 5:162247776-162247798 AGTCAAGGCAGGAAACAGGCTGG - Intergenic
1000756372 5:165165744-165165766 AGTGAAGGAAGACCTCTGGAAGG - Intergenic
1001082215 5:168675840-168675862 AGTGATGGCAGAGGACATGCAGG + Intronic
1001348161 5:170928298-170928320 AGTTAAGACAAACCACAGACTGG - Intronic
1001444814 5:171774991-171775013 AATGAAGTCAGAACAGAGGCAGG + Intergenic
1004292885 6:14384395-14384417 AGAGAAGGAAGAGGACAGGCAGG - Intergenic
1004307716 6:14515979-14516001 AGGGAAGGCAGGCAACAGACAGG - Intergenic
1007426538 6:41749675-41749697 AGACAGGGCAGACCACAGGCAGG - Intronic
1009415991 6:63417122-63417144 ACTGAAGAGAGACTACAGGCTGG + Intergenic
1010656259 6:78514954-78514976 AGTGAGGGCAGACAAGAGGATGG - Intergenic
1011728810 6:90238596-90238618 GGTGAAGGCATAAAACAGGCTGG + Intronic
1013308468 6:108871743-108871765 AGAGCATGCAGACAACAGGCAGG - Intronic
1015771436 6:136772211-136772233 AATAATGGGAGACCACAGGCTGG - Intronic
1015921343 6:138269206-138269228 AGAGAAGGGAGAGCCCAGGCTGG - Intronic
1017630718 6:156393897-156393919 AGTCAAGGCAGGCCACATGGAGG + Intergenic
1019369717 7:655305-655327 AGTGAAGCCAGAGCAGAGCCTGG - Intronic
1020058096 7:5132491-5132513 TGTGAAGGCAGACATCAGGGTGG + Intergenic
1020788515 7:12596392-12596414 AGTGAATGCAGACATCAGGGAGG - Intronic
1022261945 7:28714258-28714280 ATCAAAAGCAGACCACAGGCTGG - Intronic
1022293083 7:29022513-29022535 GGTGAAGGCAGTGCAGAGGCAGG - Intronic
1023911569 7:44560298-44560320 GGTGAAGCCAGACCACTAGCAGG + Intergenic
1024015166 7:45307210-45307232 TCTAAAGGCAGACCAGAGGCTGG - Intergenic
1024240932 7:47435287-47435309 AGTGAATGACGACCACATGCTGG + Exonic
1025161629 7:56666353-56666375 CGTGAATGCAGTCCACAGGTAGG + Intergenic
1025236635 7:57239231-57239253 AGTGCAGGCAGCCCCCAAGCTGG - Intergenic
1025744097 7:64227695-64227717 ACTGTAGGCAGGGCACAGGCAGG + Intronic
1025745863 7:64242144-64242166 TGTGAATGCAGTCCACAGGTAGG - Intronic
1025749570 7:64281678-64281700 CGTGAATGCAGTCCACAGGTAGG - Intergenic
1025750551 7:64290333-64290355 TGTGTAGGCAGGCTACAGGCGGG + Intergenic
1025751757 7:64299944-64299966 CCTGAAGGCAGAGCCCAGGCAGG + Intergenic
1025912151 7:65837877-65837899 AGAGAAGGCGGAGCTCAGGCGGG - Intergenic
1025977405 7:66379720-66379742 AGAGAAGGCAGAGCTCAGGCAGG + Intronic
1026563389 7:71469102-71469124 AGTGAAGGCACAGCAGAGGAGGG + Intronic
1028093674 7:86733790-86733812 AGTGAACCCAGACAACAGCCTGG + Intronic
1028093867 7:86736293-86736315 AGTTAAGGCACACCACCTGCAGG - Intronic
1031951866 7:127901101-127901123 AAGGTAGGCAGACCGCAGGCTGG - Intronic
1032281914 7:130510571-130510593 TATGAAGGCAGATCACAGACTGG + Intronic
1032314117 7:130818673-130818695 ACTGAAGACAGACCACAGACTGG - Intergenic
1033157296 7:138967899-138967921 AGTGGAGGCAGATGACAGGCTGG - Intronic
1033521516 7:142165861-142165883 AATGAGTGCAGATCACAGGCAGG - Intronic
1035285835 7:157806786-157806808 AGTCCAGGCAGACCACGGCCCGG + Intronic
1038647529 8:29373790-29373812 AGTGGAGGCAGGGCACAGGATGG - Intergenic
1039431247 8:37526806-37526828 GGTGAAGACAGACCGAAGGCGGG + Intergenic
1040648655 8:49426568-49426590 AGTGAAGGCAGAGACCAGCCAGG - Intergenic
1040948893 8:52915919-52915941 AGTGAATGGGGACAACAGGCTGG + Intergenic
1041174658 8:55182198-55182220 TGAGAAGGCAAGCCACAGGCTGG - Intronic
1042797092 8:72676427-72676449 AGAGAGGGCAGATCAGAGGCAGG - Intronic
1044088208 8:87968273-87968295 ATTAAAGGCAGACCCCAGGGAGG + Intergenic
1044471303 8:92571917-92571939 AGTGAAGGAAGAGGACAAGCTGG + Intergenic
1045815066 8:106269905-106269927 AGTGCAGGCAGACGCCTGGCAGG + Intergenic
1046773457 8:118139171-118139193 AGTGAAGTCAGACCAGAGATTGG + Intergenic
1049459321 8:142716373-142716395 ACAGGAGGCAGACCTCAGGCTGG + Intergenic
1049502605 8:142975355-142975377 AGGGAAGAGAGAGCACAGGCTGG + Intergenic
1049692809 8:143969984-143970006 AGAGAGTGCAGGCCACAGGCTGG - Intronic
1051481317 9:17564456-17564478 AGTAAAGGGAGACAACAGGCTGG + Intergenic
1053011092 9:34633934-34633956 GGAGAAGGCAGACCATAGACTGG + Intergenic
1054160445 9:61669126-61669148 AGTGAGGACAGATCAGAGGCCGG + Intergenic
1055101106 9:72466625-72466647 AGTGAAGGCCTAACCCAGGCAGG - Intergenic
1056817819 9:89814496-89814518 AGGGAAGGCAGAGAACAGGCTGG + Intergenic
1057412377 9:94828150-94828172 AATGAAGCCAGCCCACAGGGTGG - Intronic
1058812679 9:108656544-108656566 AGTGAAGGAAGACCCCACGGAGG + Intergenic
1061591062 9:131597865-131597887 AGTGAGGGCCGGCCACATGCAGG + Intronic
1061719789 9:132544463-132544485 AGTGAGGAAAGACCACAGCCAGG - Intronic
1061949112 9:133926333-133926355 AGGGAAGGGAGACAACAGGTGGG + Intronic
1062045854 9:134424185-134424207 GCTGCAGGGAGACCACAGGCAGG - Intronic
1185445080 X:253654-253676 GGAGCAGGCAGACCTCAGGCAGG - Intergenic
1188948171 X:36334286-36334308 AGGGAAGGCAGACCATATGGTGG - Intronic
1189891906 X:45611264-45611286 TGAGAAGACAAACCACAGGCTGG - Intergenic
1192367586 X:70487247-70487269 AGTGCAGGCTGTCCACAGTCAGG + Intronic
1194896373 X:99446446-99446468 AGAGAAGACAGGCCACAGACTGG - Intergenic
1195349513 X:103983504-103983526 AATGATGGTTGACCACAGGCGGG + Intergenic
1195357930 X:104055335-104055357 AATGATGGTTGACCACAGGCGGG - Intergenic
1197666856 X:129233602-129233624 AGTGAACCCTGACCACAAGCTGG + Intergenic
1199609724 X:149602207-149602229 AATGAAGACAGGCCACAGACTGG - Intronic
1199794780 X:151183642-151183664 GGTGCAGGCAGCCCTCAGGCAGG - Intergenic
1200076033 X:153551504-153551526 AGTGAAGACAGGCCACAGAATGG - Intronic