ID: 948015104

View in Genome Browser
Species Human (GRCh38)
Location 2:234682677-234682699
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 225}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948015100_948015104 8 Left 948015100 2:234682646-234682668 CCAGTTGGGGCATGTTCTTTTCA No data
Right 948015104 2:234682677-234682699 GCAGACCACAGGCTGGCAAATGG 0: 1
1: 0
2: 1
3: 26
4: 225
948015093_948015104 28 Left 948015093 2:234682626-234682648 CCCTCCTGGGACCAGAGAGGCCA No data
Right 948015104 2:234682677-234682699 GCAGACCACAGGCTGGCAAATGG 0: 1
1: 0
2: 1
3: 26
4: 225
948015099_948015104 17 Left 948015099 2:234682637-234682659 CCAGAGAGGCCAGTTGGGGCATG No data
Right 948015104 2:234682677-234682699 GCAGACCACAGGCTGGCAAATGG 0: 1
1: 0
2: 1
3: 26
4: 225
948015095_948015104 24 Left 948015095 2:234682630-234682652 CCTGGGACCAGAGAGGCCAGTTG No data
Right 948015104 2:234682677-234682699 GCAGACCACAGGCTGGCAAATGG 0: 1
1: 0
2: 1
3: 26
4: 225
948015094_948015104 27 Left 948015094 2:234682627-234682649 CCTCCTGGGACCAGAGAGGCCAG No data
Right 948015104 2:234682677-234682699 GCAGACCACAGGCTGGCAAATGG 0: 1
1: 0
2: 1
3: 26
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type