ID: 948015104

View in Genome Browser
Species Human (GRCh38)
Location 2:234682677-234682699
Sequence GCAGACCACAGGCTGGCAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 225}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948015095_948015104 24 Left 948015095 2:234682630-234682652 CCTGGGACCAGAGAGGCCAGTTG No data
Right 948015104 2:234682677-234682699 GCAGACCACAGGCTGGCAAATGG 0: 1
1: 0
2: 1
3: 26
4: 225
948015093_948015104 28 Left 948015093 2:234682626-234682648 CCCTCCTGGGACCAGAGAGGCCA No data
Right 948015104 2:234682677-234682699 GCAGACCACAGGCTGGCAAATGG 0: 1
1: 0
2: 1
3: 26
4: 225
948015100_948015104 8 Left 948015100 2:234682646-234682668 CCAGTTGGGGCATGTTCTTTTCA No data
Right 948015104 2:234682677-234682699 GCAGACCACAGGCTGGCAAATGG 0: 1
1: 0
2: 1
3: 26
4: 225
948015094_948015104 27 Left 948015094 2:234682627-234682649 CCTCCTGGGACCAGAGAGGCCAG No data
Right 948015104 2:234682677-234682699 GCAGACCACAGGCTGGCAAATGG 0: 1
1: 0
2: 1
3: 26
4: 225
948015099_948015104 17 Left 948015099 2:234682637-234682659 CCAGAGAGGCCAGTTGGGGCATG No data
Right 948015104 2:234682677-234682699 GCAGACCACAGGCTGGCAAATGG 0: 1
1: 0
2: 1
3: 26
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948015104 Original CRISPR GCAGACCACAGGCTGGCAAA TGG Intergenic
901941214 1:12663365-12663387 GCAGTCTACAGCCTGGAAAAGGG - Intronic
904234384 1:29105132-29105154 GCAGAGCACTGGCTGCCTAAAGG - Intronic
904463677 1:30695195-30695217 TCTGCCCACAGGCTGGAAAAAGG + Intergenic
908258087 1:62318884-62318906 GCAGACCCCAGGCTGGGAGGCGG + Intronic
908532399 1:65046353-65046375 GGAGCCCACAGGATGGAAAACGG + Intergenic
909716167 1:78709622-78709644 GCAACCCACAGACTGGGAAAAGG + Intergenic
909818220 1:80024604-80024626 GAAGACCAAAGGATGGCCAAAGG - Intergenic
910368604 1:86492518-86492540 GTAGATCACAAGCTGGCAAGTGG - Intronic
910498132 1:87856302-87856324 TCAGACCACAGAGAGGCAAACGG - Intergenic
911077487 1:93891626-93891648 CCAGAACAATGGCTGGCAAATGG + Intronic
915314015 1:155018035-155018057 GCAGAGCCCAGGCTGCAAAAGGG - Exonic
919107599 1:193172724-193172746 TCAGAACACAGGATGGCAAAAGG - Intronic
919622570 1:199879444-199879466 GGTTACCACAGGCTGGCAAACGG + Intergenic
920316368 1:205078209-205078231 GCAGAGCACAGGCAGGCATTTGG + Exonic
920365053 1:205443899-205443921 AGAGACCACAGCCTGGCAGAGGG - Intronic
922740319 1:228010727-228010749 GCAGGCCAGGGGCAGGCAAAAGG - Intronic
1063440311 10:6067594-6067616 GGAGACTACAGGCTGCCAAGAGG + Intergenic
1064175546 10:13072011-13072033 GAAGTCCAAATGCTGGCAAAAGG + Intronic
1067057876 10:43062855-43062877 GCAGATCCCAGGCAGGCAGAGGG + Intergenic
1070564233 10:77591253-77591275 GCAGGGCAAAGGCAGGCAAAAGG + Intronic
1071992869 10:91116904-91116926 CCAGAACACAGGCTGGGAAGAGG - Intergenic
1072744868 10:97932976-97932998 GCATCCCAAAGGCTGGCCAAGGG + Intronic
1075081000 10:119383865-119383887 GCAGGCCACAGTTTGGCACAAGG + Intronic
1076352770 10:129829710-129829732 GCAGACACCAGACTGGCAAGTGG - Intergenic
1076788108 10:132761296-132761318 GGAGACCACACGCTGGGAACAGG + Intronic
1077985562 11:7347890-7347912 GGAAACCACAGGCTGGCAGAAGG + Intronic
1078736222 11:14023624-14023646 GCAGATCACAGCCTGCCAACTGG + Intronic
1080433738 11:32221242-32221264 GCATATCCCAGGCAGGCAAAGGG - Intergenic
1080649791 11:34212924-34212946 GGAGATAAAAGGCTGGCAAAGGG + Intronic
1083049705 11:59766124-59766146 CCAGACCCCAGGCAGACAAAAGG - Intronic
1083897537 11:65627602-65627624 CCAGACCCCAGGCTGTCCAATGG + Intronic
1084364185 11:68686768-68686790 GCAGAGCTCAGGGTTGCAAAGGG - Intronic
1086312215 11:85548384-85548406 GCAGAGCTCAGGCTGGCATCTGG - Intronic
1088355591 11:108940647-108940669 ACAGAACACATGCTGGAAAACGG - Exonic
1088480639 11:110293690-110293712 GCAGACCACGAGCTGGCAGGTGG - Intronic
1089055178 11:115579567-115579589 TCAGAACACAGGCTGGGAACAGG - Intergenic
1089613134 11:119680807-119680829 GCACCCCACAGGCTGGCAGAGGG - Intronic
1089729956 11:120513144-120513166 GCTGCCCACTGCCTGGCAAAAGG - Intronic
1090891622 11:130928730-130928752 GCAAGCCACAGGCTGGGAGAAGG - Intergenic
1091214303 11:133891217-133891239 ACTCACCACTGGCTGGCAAAAGG - Intergenic
1091592362 12:1851519-1851541 GCAGACCACAGGAACCCAAAAGG - Intronic
1095486474 12:42689846-42689868 GAGGACCACACGCTGGCAGAAGG + Intergenic
1097036778 12:56129374-56129396 GCAGCCCACAGTCCGGAAAAGGG - Intronic
1099321764 12:81159861-81159883 GCAGATGACAGTCTGGTAAAGGG - Intronic
1100306259 12:93352616-93352638 TCAGACCACAGGCCTGCAAATGG - Intergenic
1100822262 12:98442549-98442571 GCAGACCTCATGCAGGCAGAGGG + Intergenic
1100938774 12:99701695-99701717 GGTGACCAGAGGCTGGGAAAGGG - Intronic
1101246787 12:102891228-102891250 GGAGCTCACAGCCTGGCAAAGGG - Intronic
1101921898 12:108939879-108939901 ACAGACAACAGACTTGCAAAAGG - Intronic
1103514808 12:121500606-121500628 GCCATCCACAGGCCGGCAAAGGG + Intronic
1104384562 12:128339174-128339196 ACAGACCACATGCTGGCAGTGGG - Intronic
1104394259 12:128418400-128418422 GCAGGCAACAGTGTGGCAAATGG + Intronic
1106287081 13:28327601-28327623 GCAGGCTGAAGGCTGGCAAATGG - Intronic
1107583141 13:41814183-41814205 CCAGGCCGCAGGCTGGGAAATGG + Intronic
1107636302 13:42395768-42395790 GCAGGGCAGAGGCTGGCAACAGG - Intergenic
1107935579 13:45342687-45342709 GCAGGACACAGGATGGCAATTGG + Intergenic
1113155884 13:107321265-107321287 GAAGAGAACAGGCTGGCTAAAGG + Intronic
1113408539 13:110063554-110063576 GCAGAGCACTGGCTGGCAAGGGG + Intergenic
1113949796 13:114065639-114065661 ACAGACCGCAGGCTGGAGAATGG + Intronic
1114059683 14:19007790-19007812 GCAGACCACAGGCTGTCTAGAGG + Intergenic
1114102863 14:19393961-19393983 GCAGACCACAGGCTGTCTAGAGG - Intergenic
1117238044 14:53798915-53798937 GCAGACCTCTGGCTGGCATCTGG + Intergenic
1119534709 14:75393669-75393691 ACAGAAAACAGGATGGCAAAGGG + Intergenic
1119745276 14:77039403-77039425 GCAGACATCAGGTTAGCAAAAGG + Intergenic
1119965042 14:78905183-78905205 GTAGAACACAGGCTGGGCAAAGG - Intronic
1122229355 14:100297875-100297897 GCAGAAAACCGGCTGGCAGAGGG + Intronic
1122629321 14:103100074-103100096 GCAGCCCTCAGGCTGTCAAAAGG - Intergenic
1123150736 14:106179292-106179314 GCAGACCACACTCGGTCAAATGG + Intergenic
1202837077 14_GL000009v2_random:86263-86285 GCAGACCACAGGCTGTCTTGAGG + Intergenic
1123553222 15:21401372-21401394 GCAGACCACAGGCTGTCTTGAGG - Intergenic
1123589467 15:21838760-21838782 GCAGACCACAGGCTGTCTTGAGG - Intergenic
1124622265 15:31280398-31280420 GCAGACCTGAGGCCGGGAAAGGG + Intergenic
1125509685 15:40286283-40286305 GCAGGCCCCAGGCTGGCAGAAGG + Intronic
1128753816 15:70167478-70167500 CCAGAGCACAGGCTAGAAAATGG + Intergenic
1129340393 15:74882162-74882184 GAAGACCTCCGGCTGACAAAGGG - Intergenic
1131123896 15:89841901-89841923 TAAGACCACAGACTGGAAAAGGG + Intronic
1202961570 15_KI270727v1_random:128592-128614 GCAGACCACAGGCTGTCTTGAGG - Intergenic
1133695431 16:8258380-8258402 GCAGACCACAAGCTGGCTACAGG - Intergenic
1135889180 16:26341927-26341949 ACAGACCACAGGTTGGCAGTGGG + Intergenic
1136566189 16:31072193-31072215 CCAGAGTCCAGGCTGGCAAAGGG + Intronic
1139916012 16:70428888-70428910 GCAGAGCACAGGATGTAAAAGGG + Intronic
1141936185 16:87239806-87239828 GGAGAACACAGGCAGGCAAGGGG - Intronic
1142581492 17:945913-945935 GCAAACCACAGGCTGGAAACTGG + Intronic
1143566777 17:7726728-7726750 GGAGACCACAAGCTGGAAAAGGG - Intronic
1143886883 17:10071514-10071536 GCAGACCAGAGGCTGCCTACAGG + Intronic
1144165259 17:12604331-12604353 CCAGACCACAGGATGCCAAGAGG + Intergenic
1146005300 17:29156935-29156957 GCGGAGCACAGCCTGGCAGAGGG - Intronic
1146638467 17:34523094-34523116 GTAGACCATAGGCTGCAAAAGGG + Intergenic
1147429227 17:40361601-40361623 GCAGCCCACTGGCTGGTGAAGGG + Intronic
1148885872 17:50772300-50772322 GCAGCCTACAGGGTGGCAAGTGG - Intergenic
1150004246 17:61460023-61460045 GCAGGGCCCAGGCTGACAAATGG - Intronic
1151670302 17:75568537-75568559 GCAGACAGCAGGCTGGCCACCGG + Exonic
1153623878 18:7005082-7005104 GCACACCACAGGCTGGTGAACGG + Intronic
1154453908 18:14503489-14503511 GCAGACCACAGGCTGTCTTGAGG - Intergenic
1160046533 18:75391982-75392004 GCAGGCAACAGGATGGGAAAGGG - Intergenic
1160972066 19:1773946-1773968 GCAGACCAGACACTTGCAAAGGG - Intronic
1161422678 19:4184475-4184497 GCAGGGCACAGGCCGGCAAGTGG - Intronic
1161684335 19:5695567-5695589 GCCCACCACTGGCTGTCAAAGGG + Intronic
1161737021 19:5997579-5997601 TCAGAGCACAGGCTGGCAGCTGG + Intronic
1161895161 19:7074714-7074736 GCAGATCACAGGCTGGAGAGGGG + Intronic
1164797491 19:31045821-31045843 GCAGCCCACAGGGTGGCATCTGG + Intergenic
1165102139 19:33445182-33445204 CCAGACCAGAGGCTGACACATGG + Intronic
1166344395 19:42156340-42156362 ACAGAGCACAGGCAGCCAAAAGG + Intronic
1167320468 19:48794677-48794699 GCAGACTGCAGGCTGGAACAAGG + Intergenic
1167696784 19:51019669-51019691 GCAGACCACAGGCAGGGCAGAGG - Intronic
1168450806 19:56465215-56465237 GCAGGACACAGCCTGGAAAATGG + Intronic
1202635557 1_KI270706v1_random:41088-41110 GCAGACCACAGGCTGTCTTGAGG - Intergenic
926271714 2:11371765-11371787 CCAGGCCACAGTCTGCCAAAGGG + Intergenic
927731823 2:25480279-25480301 GCAGACCAAAGGCAGCCAGAGGG - Intronic
928220694 2:29400630-29400652 GCAGCACTCAGGCTGGGAAAAGG - Intronic
929253669 2:39786119-39786141 TCAGAGCACAGGCTGGTAAGGGG + Intergenic
930016012 2:46970945-46970967 TCACACCCCAGCCTGGCAAAGGG + Intronic
930095043 2:47560484-47560506 GCAGACCCCAGGCTGGGCTATGG + Intronic
930833415 2:55769882-55769904 GCAGAACACAGCCTGGCTCATGG + Intergenic
931894345 2:66712597-66712619 GCAGCCCAGAGCCTGGCAGATGG + Intergenic
932487748 2:72094759-72094781 GCAGACCACTGGGTGGCAACTGG - Intergenic
933645499 2:84809795-84809817 GCTTCCCACTGGCTGGCAAAAGG - Intronic
934859450 2:97751785-97751807 GCAGACCACACGGTGAGAAAGGG + Intergenic
934994501 2:98944915-98944937 GCAGGCCACAGACTGGGAGAAGG - Intergenic
938230631 2:129655692-129655714 CAAGACCACAGGCCGGCAAGTGG - Intergenic
938280440 2:130060245-130060267 GCAGACCACAGGCTGTCTTGAGG - Intergenic
938280728 2:130061954-130061976 GCAGACCACAGGCTGTCTTGAGG - Intergenic
938281157 2:130064575-130064597 GCAGACCACAGGCTGTCTTGAGG - Intergenic
938331373 2:130450784-130450806 GCAGACCACAGGCTGTCTTGAGG - Intergenic
938331673 2:130452593-130452615 GCAGACCACAGGCTGTCTTGAGG - Intergenic
938331777 2:130453233-130453255 GCAGACCACAGGCTGTCTTGAGG - Intergenic
938358578 2:130670719-130670741 GCAGACCACAGGCTGTCTTGAGG + Intergenic
938434222 2:131272766-131272788 GCAGACCACAGGCTGTCTTGAGG + Intronic
938434544 2:131274756-131274778 GCAGACCACAGGCTGTCTTGAGG + Intronic
938478231 2:131635260-131635282 GCAGACCACAGGCCGTCATGAGG - Intergenic
938713036 2:133991957-133991979 GCAGGCCCCAGCCTGGCAACAGG + Intergenic
938803705 2:134786923-134786945 AAAGACCACAGTGTGGCAAAAGG + Intergenic
943573282 2:189600085-189600107 ACAGCCCACAGCCTGGAAAATGG + Intergenic
943627214 2:190214543-190214565 AAAGACCAAAGGCTGACAAATGG - Intronic
948015104 2:234682677-234682699 GCAGACCACAGGCTGGCAAATGG + Intergenic
948845279 2:240680121-240680143 GGAGGCCACAGGCTGGGGAAAGG - Intronic
948848581 2:240694758-240694780 GGAGGCCACAGGCTGGGGAAAGG + Intronic
948935071 2:241158638-241158660 GCCGCCCACAGGCTGGGACAAGG - Intronic
1169979934 20:11373034-11373056 TCAGACCACAGGCCGACACATGG - Intergenic
1170040143 20:12031797-12031819 GCAGAACACAGTCATGCAAAAGG + Intergenic
1172664058 20:36587006-36587028 GCAAAACACAGGCTGGGAACCGG - Intronic
1172749956 20:37243865-37243887 ACAGAACACAGCCTGGCACATGG - Intergenic
1174219953 20:48946353-48946375 GCAGACCAAATGCTGGAGAAAGG - Intronic
1176082610 20:63281571-63281593 TCAGACCAGCTGCTGGCAAAGGG + Intronic
1176148842 20:63578698-63578720 GCAGACGGCAGGCTGGCACTGGG - Intergenic
1176820262 21:13649807-13649829 GCAGACCACAGGCTGTCTTGAGG + Intergenic
1176908065 21:14528435-14528457 GCAGCCCAGAGGCAGGCAGAGGG - Intronic
1178084122 21:29095319-29095341 ATAGCCCACAGGCTGGGAAACGG - Intronic
1179246535 21:39638400-39638422 GCAGGCCACCGACTGGCAGAAGG + Intronic
1180365152 22:11932139-11932161 GCAGACCACAGGCTGTCTTGAGG + Intergenic
1180478163 22:15730402-15730424 GCAGACCACAGGCTGTCTAGAGG + Intergenic
1181305772 22:21916490-21916512 GCAGGCCACAGTGTGGCAAGTGG - Intergenic
1184769179 22:46587934-46587956 TCACATCACAGGTTGGCAAAAGG + Intronic
1185161934 22:49235394-49235416 AAAGAACACAGGCTAGCAAATGG - Intergenic
952108396 3:30094537-30094559 GCAGGAGACAGGATGGCAAAAGG - Intergenic
953346394 3:42179356-42179378 GCCTGCCACAGGCAGGCAAATGG + Intronic
953998105 3:47536184-47536206 GCTACCCACAGGCTGGCACAAGG - Intergenic
954810533 3:53244528-53244550 GCTGGCCACAGGCAGGCAAGAGG + Intronic
959040844 3:101421997-101422019 ACAGACCACAGACTGGTACAAGG - Intronic
961058039 3:123805305-123805327 GAAGCCCAAAGCCTGGCAAACGG + Intronic
961556909 3:127702136-127702158 GAAGAGCACAGGCTTCCAAAAGG - Intronic
962369283 3:134807368-134807390 GCAGACTACAGGCTGTAATAGGG + Intronic
962369615 3:134810433-134810455 GCATAGAACAGCCTGGCAAATGG + Intronic
964449049 3:156792293-156792315 GCAGACCAGAGGTTGCAAAATGG - Intergenic
965483759 3:169252798-169252820 GTAGACAACAGGCTAGCAGATGG + Intronic
966917516 3:184593203-184593225 GCAGACCACAGAGTGGCAGGAGG - Intronic
969425644 4:7122327-7122349 TGAGGCCACAGGCTGGGAAATGG - Intergenic
969620228 4:8275238-8275260 GAAGACCACAGGATGGCAGATGG - Intronic
969620805 4:8277853-8277875 GCTGACCACTGGGTGGCAGAGGG + Intronic
969669372 4:8581286-8581308 GCAGACCAGTGGCTGGCAGTGGG + Exonic
970584318 4:17500565-17500587 GAAGACCACATGCAGACAAAAGG + Intronic
970711530 4:18869324-18869346 GCAAAACACAGGCTTGCCAAAGG - Intergenic
972866989 4:43244750-43244772 GGAGACCCCAGGCTGGGGAAGGG + Intergenic
973826520 4:54712523-54712545 GCAGACCACACACTGGCAAATGG - Intronic
975151678 4:71029386-71029408 GAAGACTACAGGCAGCCAAATGG + Exonic
983094684 4:163547579-163547601 GAAGACAACAGGATGGCCAAAGG - Intronic
983546960 4:168975203-168975225 CCAGACTCCAGGCTGGCAATGGG + Intronic
984157473 4:176209695-176209717 GCAGACGACAGGCAGGCAGGTGG - Intergenic
985202949 4:187503439-187503461 ACAGACCACAGGAGAGCAAAAGG - Intergenic
1202762875 4_GL000008v2_random:126967-126989 GCAGACCACAGGCTGTCTTGAGG - Intergenic
985911753 5:2889688-2889710 GGAGTCCGCAGGATGGCAAAAGG - Intergenic
986127812 5:4899525-4899547 GCAGGACACATGCTGGCAGAAGG - Intergenic
987473118 5:18356916-18356938 GCTGGACACAGGCTGACAAAGGG + Intergenic
988277812 5:29105383-29105405 GAAGATCAGAAGCTGGCAAAAGG - Intergenic
989427054 5:41307957-41307979 CCTCACAACAGGCTGGCAAAGGG + Exonic
993806401 5:92416111-92416133 GAAGACTACAGGATTGCAAAAGG + Intergenic
994726874 5:103446467-103446489 GTAGAACATAGGATGGCAAATGG - Intergenic
995530487 5:113087100-113087122 GCAGAGAACAGGCAGGCACATGG + Intronic
999038886 5:148384752-148384774 GCAGACACCAAGCTGGCCAAGGG + Intronic
1000610970 5:163373948-163373970 GCTTACCAGAGGCTGGCAGAGGG + Intergenic
1000899251 5:166893186-166893208 GAAGATCACATGCTGGAAAAAGG - Intergenic
1001406960 5:171483342-171483364 GCAGATCTCAGGATGTCAAAGGG + Intergenic
1003490769 6:6619649-6619671 GCAGAACACAGGCTGGCCCCAGG - Intronic
1006173044 6:32106390-32106412 CCAGACCAGAGGCTGGGGAAAGG + Intronic
1007222063 6:40286626-40286648 GCAGACGACAGGTTGGAGAAGGG - Intergenic
1007722350 6:43892488-43892510 GCAGACCAGAAGGTGGCTAAGGG + Intergenic
1011053907 6:83185205-83185227 GCAGGCCACAGCCTGCCAATGGG + Intronic
1014657730 6:124129055-124129077 GCAGAGTACAGGGTCGCAAAGGG - Intronic
1016369426 6:143356940-143356962 GAAGATCACAGGCTGCCATAGGG + Intergenic
1017490158 6:154937951-154937973 CCAGACCACAGTTTGGCAACTGG - Intronic
1017538623 6:155376221-155376243 GCAGACCACAGGCTGCGAGTTGG - Intergenic
1017550150 6:155496940-155496962 GTAGACCAGAGGCTGTCCAATGG + Intergenic
1018653074 6:166007404-166007426 GCAGAACACAGGCTGGGAAGAGG - Intergenic
1019228118 6:170532161-170532183 CCATAGCACAGGCTGTCAAAGGG - Intergenic
1019308743 7:348613-348635 GCAGACCACAGGTTGGTGACGGG + Intergenic
1019656052 7:2196576-2196598 CCAGCCCAAAGCCTGGCAAACGG + Intronic
1020600416 7:10268460-10268482 GCAGTCCATAGCCTGGCAAAAGG - Intergenic
1024474671 7:49798142-49798164 AAAGAGCACAGCCTGGCAAAAGG + Intronic
1024811360 7:53216714-53216736 GCAGACCACTGGAAGGCAAATGG + Intergenic
1024865103 7:53896345-53896367 GCAGCCCTCAGTCTGGCCAAAGG - Intergenic
1027469911 7:78560717-78560739 GCAGACAAAAGGCTATCAAAGGG - Intronic
1029380769 7:100213089-100213111 GCAGTCTACAGGCTGGAAGAAGG - Intronic
1031196943 7:118627456-118627478 GCCGCCCACAGCATGGCAAATGG - Intergenic
1031960490 7:127985135-127985157 GCACACCACAAGCTGGGAATGGG - Intronic
1032538164 7:132681868-132681890 GCAGGCTACATGCTGGCAAAGGG + Intronic
1035296295 7:157868599-157868621 CCAGTCCTCAGGCTGGGAAATGG - Intronic
1036806497 8:11837943-11837965 ACAGACCACAGCTTGACAAAGGG - Intronic
1037211373 8:16392457-16392479 GAAGACCACAGGAGAGCAAAAGG + Intronic
1040536375 8:48314670-48314692 GCAGACCCCAGGCTGGCTGATGG - Intergenic
1040536991 8:48319185-48319207 GCAGAGCACAGGCGGGCAGATGG - Intergenic
1042736107 8:71991216-71991238 GCTGACCACAGGCTGTGGAAAGG + Intronic
1043879365 8:85524412-85524434 CCAGACCACAGGCTGCCACGCGG - Intergenic
1045967922 8:108047550-108047572 CCTGACCACAGGCTTCCAAAAGG - Intronic
1046249547 8:111612055-111612077 GCCGCCCACAGCTTGGCAAATGG + Intergenic
1046701166 8:117402747-117402769 GAACACTCCAGGCTGGCAAAAGG + Intergenic
1047683860 8:127283640-127283662 GCAGACCAAAGAGTTGCAAATGG + Intergenic
1047844841 8:128794554-128794576 GCAACCCACAGGCAGGCAAAGGG + Intergenic
1048058297 8:130890718-130890740 AGAGACCACAGGCTGGCAAGGGG + Intronic
1049601426 8:143509548-143509570 GCAGGCTGCAGGCTGGCAAGTGG - Intronic
1050075069 9:1854672-1854694 GCAGACCACAGGCCTTCAGAGGG + Intergenic
1055350951 9:75387706-75387728 GCACACCACAGGCTGACAGGTGG - Intergenic
1055989077 9:82085905-82085927 ACAGAACACATGCTGGAAAATGG + Intergenic
1056380281 9:86051583-86051605 GCAGACCAGAGGCTGCCTGAGGG + Intronic
1057507412 9:95647288-95647310 GAAGACCAGAGGCGGGCAAGTGG - Intergenic
1059006354 9:110407101-110407123 GCAGTCCACAGGAATGCAAATGG + Exonic
1060555843 9:124506811-124506833 GCAGAACCCAGGCTGACAGATGG + Intronic
1060665652 9:125430749-125430771 GCAGACCACTGGCTGCCACTGGG + Intergenic
1060770447 9:126327829-126327851 GAAGACCACAGGAGGGCAAAAGG + Intronic
1061217633 9:129231082-129231104 GGAGACCACAGGATGGCCATCGG + Intergenic
1061511989 9:131067220-131067242 CCAGACCCCAGGGTGGCACATGG + Intronic
1061518359 9:131102780-131102802 GCAGCCCACAGGCTCTTAAAGGG - Intronic
1062636731 9:137495376-137495398 GGACACCACAGGCTGGAACAAGG + Intronic
1203527097 Un_GL000213v1:99744-99766 GCAGACCACAGGCTGTCTTGAGG - Intergenic
1203543638 Un_KI270743v1:111848-111870 GCAGACCACAGGCTGTCTTGAGG - Intergenic
1187467558 X:19540605-19540627 GCTGACCCCAGACTGGCAGAGGG + Intronic
1188724284 X:33562302-33562324 GGAGACCAGAGGCTGGGAAGAGG - Intergenic
1189199359 X:39178340-39178362 CCTGACCACAGACTGCCAAAAGG + Intergenic
1191243869 X:58210598-58210620 GGAGACAACTGGCTGACAAAAGG + Intergenic
1194504016 X:94710418-94710440 GCAGACCTCAACCTGCCAAAGGG - Intergenic
1196680554 X:118465622-118465644 GAAGAGAACAGGCTGGGAAAGGG - Intergenic
1197833017 X:130665459-130665481 CCAGACCACCTGCTGTCAAAAGG - Intronic
1199785389 X:151100649-151100671 GCAGACCACAGGCTTCCTGATGG - Intergenic
1200231527 X:154446175-154446197 GCCAAGCACAGGCTGGCAATGGG - Intronic