ID: 948015105

View in Genome Browser
Species Human (GRCh38)
Location 2:234682682-234682704
Sequence CATTTCCATTTGCCAGCCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 210}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948015105_948015106 -6 Left 948015105 2:234682682-234682704 CCACAGGCTGGCAAATGGAAATG 0: 1
1: 0
2: 1
3: 19
4: 210
Right 948015106 2:234682699-234682721 GAAATGCATGATGCTTCCTAAGG 0: 1
1: 0
2: 0
3: 8
4: 167
948015105_948015107 0 Left 948015105 2:234682682-234682704 CCACAGGCTGGCAAATGGAAATG 0: 1
1: 0
2: 1
3: 19
4: 210
Right 948015107 2:234682705-234682727 CATGATGCTTCCTAAGGCCTAGG 0: 1
1: 0
2: 0
3: 20
4: 182
948015105_948015109 11 Left 948015105 2:234682682-234682704 CCACAGGCTGGCAAATGGAAATG 0: 1
1: 0
2: 1
3: 19
4: 210
Right 948015109 2:234682716-234682738 CTAAGGCCTAGGCTCAGACCTGG 0: 1
1: 1
2: 3
3: 50
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948015105 Original CRISPR CATTTCCATTTGCCAGCCTG TGG (reversed) Intergenic