ID: 948015106

View in Genome Browser
Species Human (GRCh38)
Location 2:234682699-234682721
Sequence GAAATGCATGATGCTTCCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 167}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948015105_948015106 -6 Left 948015105 2:234682682-234682704 CCACAGGCTGGCAAATGGAAATG 0: 1
1: 0
2: 1
3: 19
4: 210
Right 948015106 2:234682699-234682721 GAAATGCATGATGCTTCCTAAGG 0: 1
1: 0
2: 0
3: 8
4: 167
948015100_948015106 30 Left 948015100 2:234682646-234682668 CCAGTTGGGGCATGTTCTTTTCA No data
Right 948015106 2:234682699-234682721 GAAATGCATGATGCTTCCTAAGG 0: 1
1: 0
2: 0
3: 8
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948015106 Original CRISPR GAAATGCATGATGCTTCCTA AGG Intergenic