ID: 948022193

View in Genome Browser
Species Human (GRCh38)
Location 2:234743793-234743815
Sequence TCAGAAGGCCACTGTGGAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948022193_948022197 4 Left 948022193 2:234743793-234743815 CCTCTTCCACAGTGGCCTTCTGA No data
Right 948022197 2:234743820-234743842 GAGCACAGGAGTTCAGTGAATGG No data
948022193_948022195 -10 Left 948022193 2:234743793-234743815 CCTCTTCCACAGTGGCCTTCTGA No data
Right 948022195 2:234743806-234743828 GGCCTTCTGATTGAGAGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948022193 Original CRISPR TCAGAAGGCCACTGTGGAAG AGG (reversed) Intergenic
No off target data available for this crispr