ID: 948026599

View in Genome Browser
Species Human (GRCh38)
Location 2:234782926-234782948
Sequence CTAAAATCAAGGTGTCGGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948026599_948026602 -3 Left 948026599 2:234782926-234782948 CCGGGCCGACACCTTGATTTTAG No data
Right 948026602 2:234782946-234782968 TAGCCAAGACAGACCCATTTTGG No data
948026599_948026606 12 Left 948026599 2:234782926-234782948 CCGGGCCGACACCTTGATTTTAG No data
Right 948026606 2:234782961-234782983 CATTTTGGACTTCTCGTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948026599 Original CRISPR CTAAAATCAAGGTGTCGGCC CGG (reversed) Intergenic
No off target data available for this crispr