ID: 948029057

View in Genome Browser
Species Human (GRCh38)
Location 2:234801421-234801443
Sequence CAGTTTGAGGAGAAGGGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948029057_948029062 4 Left 948029057 2:234801421-234801443 CCTGCTCCCTTCTCCTCAAACTG No data
Right 948029062 2:234801448-234801470 ACTGACTCAGCCGCCAGGCCAGG No data
948029057_948029061 -1 Left 948029057 2:234801421-234801443 CCTGCTCCCTTCTCCTCAAACTG No data
Right 948029061 2:234801443-234801465 GTTAAACTGACTCAGCCGCCAGG No data
948029057_948029067 29 Left 948029057 2:234801421-234801443 CCTGCTCCCTTCTCCTCAAACTG No data
Right 948029067 2:234801473-234801495 GCCTGTCGTAAGGTTTGACTCGG No data
948029057_948029065 19 Left 948029057 2:234801421-234801443 CCTGCTCCCTTCTCCTCAAACTG No data
Right 948029065 2:234801463-234801485 AGGCCAGGATGCCTGTCGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948029057 Original CRISPR CAGTTTGAGGAGAAGGGAGC AGG (reversed) Intergenic
No off target data available for this crispr