ID: 948030913

View in Genome Browser
Species Human (GRCh38)
Location 2:234816685-234816707
Sequence AAAAACAGTCCGGAGACTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948030913_948030916 9 Left 948030913 2:234816685-234816707 CCTGCAGTCTCCGGACTGTTTTT No data
Right 948030916 2:234816717-234816739 TTTTTTTTAAGCTTCTTCAAGGG No data
948030913_948030915 8 Left 948030913 2:234816685-234816707 CCTGCAGTCTCCGGACTGTTTTT No data
Right 948030915 2:234816716-234816738 TTTTTTTTTAAGCTTCTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948030913 Original CRISPR AAAAACAGTCCGGAGACTGC AGG (reversed) Intergenic
No off target data available for this crispr