ID: 948032964

View in Genome Browser
Species Human (GRCh38)
Location 2:234834669-234834691
Sequence TCTTCTATCCTGAGGGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948032964_948032968 -10 Left 948032964 2:234834669-234834691 CCAGCTTCCCTCAGGATAGAAGA No data
Right 948032968 2:234834682-234834704 GGATAGAAGATGGCTGCCCTTGG No data
948032964_948032969 -9 Left 948032964 2:234834669-234834691 CCAGCTTCCCTCAGGATAGAAGA No data
Right 948032969 2:234834683-234834705 GATAGAAGATGGCTGCCCTTGGG No data
948032964_948032974 13 Left 948032964 2:234834669-234834691 CCAGCTTCCCTCAGGATAGAAGA No data
Right 948032974 2:234834705-234834727 GATAGAAGATGGCTGCCCTTGGG No data
948032964_948032975 24 Left 948032964 2:234834669-234834691 CCAGCTTCCCTCAGGATAGAAGA No data
Right 948032975 2:234834716-234834738 GCTGCCCTTGGGATAGAAGATGG No data
948032964_948032970 2 Left 948032964 2:234834669-234834691 CCAGCTTCCCTCAGGATAGAAGA No data
Right 948032970 2:234834694-234834716 GCTGCCCTTGGGATAGAAGATGG No data
948032964_948032973 12 Left 948032964 2:234834669-234834691 CCAGCTTCCCTCAGGATAGAAGA No data
Right 948032973 2:234834704-234834726 GGATAGAAGATGGCTGCCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948032964 Original CRISPR TCTTCTATCCTGAGGGAAGC TGG (reversed) Intergenic
No off target data available for this crispr