ID: 948033840

View in Genome Browser
Species Human (GRCh38)
Location 2:234841740-234841762
Sequence GGATCATGCTTGGGTGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948033831_948033840 21 Left 948033831 2:234841696-234841718 CCAGTATGTTTTTTGCTGTGTTG No data
Right 948033840 2:234841740-234841762 GGATCATGCTTGGGTGAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948033840 Original CRISPR GGATCATGCTTGGGTGAAGC AGG Intergenic
No off target data available for this crispr