ID: 948036977

View in Genome Browser
Species Human (GRCh38)
Location 2:234865656-234865678
Sequence TAGGAGAAGAGTAATGTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948036977_948036984 -7 Left 948036977 2:234865656-234865678 CCAACCACATTACTCTTCTCCTA No data
Right 948036984 2:234865672-234865694 TCTCCTAGTGTGAGGGGGAAGGG No data
948036977_948036987 13 Left 948036977 2:234865656-234865678 CCAACCACATTACTCTTCTCCTA No data
Right 948036987 2:234865692-234865714 GGGGTAATGTGAGAGCAAGCAGG No data
948036977_948036983 -8 Left 948036977 2:234865656-234865678 CCAACCACATTACTCTTCTCCTA No data
Right 948036983 2:234865671-234865693 TTCTCCTAGTGTGAGGGGGAAGG No data
948036977_948036985 -6 Left 948036977 2:234865656-234865678 CCAACCACATTACTCTTCTCCTA No data
Right 948036985 2:234865673-234865695 CTCCTAGTGTGAGGGGGAAGGGG No data
948036977_948036988 20 Left 948036977 2:234865656-234865678 CCAACCACATTACTCTTCTCCTA No data
Right 948036988 2:234865699-234865721 TGTGAGAGCAAGCAGGCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948036977 Original CRISPR TAGGAGAAGAGTAATGTGGT TGG (reversed) Intergenic
No off target data available for this crispr