ID: 948042809

View in Genome Browser
Species Human (GRCh38)
Location 2:234917052-234917074
Sequence GCCACAGTGCTCAGAAAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948042804_948042809 -2 Left 948042804 2:234917031-234917053 CCTGGTCCCCTCATTGCCAGGGC No data
Right 948042809 2:234917052-234917074 GCCACAGTGCTCAGAAAGCCAGG No data
948042805_948042809 -8 Left 948042805 2:234917037-234917059 CCCCTCATTGCCAGGGCCACAGT No data
Right 948042809 2:234917052-234917074 GCCACAGTGCTCAGAAAGCCAGG No data
948042801_948042809 1 Left 948042801 2:234917028-234917050 CCACCTGGTCCCCTCATTGCCAG No data
Right 948042809 2:234917052-234917074 GCCACAGTGCTCAGAAAGCCAGG No data
948042799_948042809 24 Left 948042799 2:234917005-234917027 CCTGATAGCAAGGGGCACAGCAG No data
Right 948042809 2:234917052-234917074 GCCACAGTGCTCAGAAAGCCAGG No data
948042806_948042809 -9 Left 948042806 2:234917038-234917060 CCCTCATTGCCAGGGCCACAGTG No data
Right 948042809 2:234917052-234917074 GCCACAGTGCTCAGAAAGCCAGG No data
948042798_948042809 25 Left 948042798 2:234917004-234917026 CCCTGATAGCAAGGGGCACAGCA No data
Right 948042809 2:234917052-234917074 GCCACAGTGCTCAGAAAGCCAGG No data
948042807_948042809 -10 Left 948042807 2:234917039-234917061 CCTCATTGCCAGGGCCACAGTGC No data
Right 948042809 2:234917052-234917074 GCCACAGTGCTCAGAAAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948042809 Original CRISPR GCCACAGTGCTCAGAAAGCC AGG Intergenic
No off target data available for this crispr