ID: 948046555

View in Genome Browser
Species Human (GRCh38)
Location 2:234950676-234950698
Sequence CAGGAGACACAGGTGGACAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 557
Summary {0: 1, 1: 0, 2: 5, 3: 55, 4: 496}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948046555_948046561 28 Left 948046555 2:234950676-234950698 CCTCTGTCCACCTGTGTCTCCTG 0: 1
1: 0
2: 5
3: 55
4: 496
Right 948046561 2:234950727-234950749 GGCAGAAAACCAGATTCCTTAGG 0: 1
1: 1
2: 0
3: 22
4: 192
948046555_948046560 7 Left 948046555 2:234950676-234950698 CCTCTGTCCACCTGTGTCTCCTG 0: 1
1: 0
2: 5
3: 55
4: 496
Right 948046560 2:234950706-234950728 AACACAGACTTCAAATGGAGTGG 0: 1
1: 1
2: 1
3: 26
4: 236
948046555_948046559 2 Left 948046555 2:234950676-234950698 CCTCTGTCCACCTGTGTCTCCTG 0: 1
1: 0
2: 5
3: 55
4: 496
Right 948046559 2:234950701-234950723 ACTTCAACACAGACTTCAAATGG 0: 1
1: 0
2: 1
3: 21
4: 288
948046555_948046562 29 Left 948046555 2:234950676-234950698 CCTCTGTCCACCTGTGTCTCCTG 0: 1
1: 0
2: 5
3: 55
4: 496
Right 948046562 2:234950728-234950750 GCAGAAAACCAGATTCCTTAGGG 0: 1
1: 0
2: 2
3: 17
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948046555 Original CRISPR CAGGAGACACAGGTGGACAG AGG (reversed) Intergenic
900402386 1:2477906-2477928 CAGGAGCCACCTGTGGCCAGGGG + Intronic
900485769 1:2921986-2922008 CTGGATAGACAGATGGACAGAGG - Intergenic
900753659 1:4417865-4417887 CATGAGCCCCATGTGGACAGGGG + Intergenic
900754763 1:4425967-4425989 GAGGAGGCACAGGCGGAAAGGGG - Intergenic
901715871 1:11153696-11153718 CAGTAGCCACATGTGGCCAGTGG - Intronic
901916757 1:12506042-12506064 CAGCAGACAAGGATGGACAGTGG - Intronic
902236914 1:15063510-15063532 CAGGTGACACAGGAGAGCAGAGG - Intronic
902563772 1:17296202-17296224 CAGGATACACTGGTAGACAGTGG - Intergenic
902606592 1:17572655-17572677 CAGCAGCCACAGGAGGCCAGCGG - Intronic
903098694 1:21007959-21007981 CAGGAGAAGCTGGAGGACAGAGG - Intronic
903361251 1:22778751-22778773 TAGAAGACACAGGGGGACAGTGG + Intronic
904030492 1:27530553-27530575 CAGGAGACTCAAGTGCAGAGAGG - Intergenic
904328707 1:29744349-29744371 GAGGACACAGAGGTGGGCAGTGG - Intergenic
904355345 1:29935120-29935142 AAGGAGACTCAGGAGGGCAGGGG - Intergenic
904750826 1:32740866-32740888 AAGGGGACAGAGGTGGTCAGCGG - Intergenic
905893728 1:41532248-41532270 CAGGAGAGAAGGGAGGACAGGGG + Intronic
906432976 1:45770704-45770726 CAGAAGAGAGAGCTGGACAGAGG + Intergenic
906541078 1:46586508-46586530 TAGGAGAAACAAGTGAACAGGGG - Intronic
906670719 1:47652446-47652468 CAGCAGACCCTGGTGGCCAGAGG - Intergenic
906716990 1:47977733-47977755 CAGGAGACATTGGAGGAGAGAGG + Intronic
907238313 1:53066515-53066537 CAGTAGCCACATGTGGCCAGTGG + Intronic
907473941 1:54692919-54692941 CAGGTCACACAGGTGGCAAGTGG - Intronic
907712478 1:56896996-56897018 AAGGTGACACAGCTGGTCAGAGG + Intronic
907933749 1:59023381-59023403 AAGGAGGCAGAGGTGGGCAGAGG + Intergenic
908424481 1:63992610-63992632 CAGAAGCCACTGGTGAACAGGGG + Intronic
909493291 1:76248820-76248842 CACGTGACAGAGGTGGAAAGAGG + Intronic
910272268 1:85409581-85409603 CAGGAGATCCAGGTGGAAAAAGG - Intronic
910281141 1:85502891-85502913 CAGGAGACAAAGGCAGGCAGAGG - Intronic
910878676 1:91902843-91902865 AAGGAGACAGCTGTGGACAGGGG + Intronic
912922567 1:113883387-113883409 CAGGAGAATCAGGTGAACCGGGG + Intronic
913380688 1:118207330-118207352 CAGTAGACAAAGATGGAAAGAGG + Intergenic
914946206 1:152068842-152068864 GAGGAGAAACAGGTGGAATGGGG - Intergenic
915974291 1:160374988-160375010 CAGGAGAAGGAGGTGGAGAGTGG + Intergenic
916015987 1:160750328-160750350 CAGGAGACACAGGAGGACCATGG - Exonic
916492744 1:165316232-165316254 AAGGACAGACAGGTGGACACTGG + Intronic
916842692 1:168615950-168615972 CAGGTGACACTGGTCCACAGAGG - Intergenic
918339263 1:183553751-183553773 GAGGAGAGAAAGGTGGACACAGG - Exonic
922237276 1:223731549-223731571 CAGGAGACAGACGTGGAAACTGG - Intronic
922720655 1:227898734-227898756 GAGGATGGACAGGTGGACAGAGG + Intergenic
922724467 1:227915943-227915965 CAGGACACACAGGTGGCCAGAGG - Intergenic
922899335 1:229123925-229123947 AAGGACACACAGGTGGACCAAGG + Intergenic
924064123 1:240206910-240206932 CTGGACACAGAGGTGGCCAGTGG + Exonic
1063318953 10:5034369-5034391 CAGGAGACACACCTGGTCACTGG + Intronic
1064492170 10:15870564-15870586 CAGGAGGCAAAGGTGGAGGGTGG + Intergenic
1064957579 10:20928322-20928344 CAGTAGTCACATGTGGCCAGTGG + Intronic
1066048805 10:31617421-31617443 CAGGGGCCTCTGGTGGACAGAGG - Intergenic
1067197360 10:44133605-44133627 AAGGAGACTTAGGTGAACAGGGG + Intergenic
1067273861 10:44817837-44817859 CATGAGACATAGGGGGACCGAGG - Intergenic
1068206021 10:53854670-53854692 CAGTAGACTTAGGTGGAGAGTGG - Intronic
1068569190 10:58609710-58609732 CACGAGGCACATGTGGCCAGTGG + Intronic
1068591015 10:58853123-58853145 AATGAGACAGAGGTGGGCAGGGG + Intergenic
1068905412 10:62316774-62316796 CAGGAGACAAAGGAGGATGGGGG - Intergenic
1069423753 10:68271494-68271516 CAGGATACAGGGATGGACAGCGG + Intergenic
1069498041 10:68924773-68924795 GAGGAGAAACTGCTGGACAGAGG - Intronic
1069860474 10:71468117-71468139 CTGGGGACAGAGGAGGACAGGGG - Intronic
1070150085 10:73800149-73800171 CAGGCCACACTGGTGGGCAGTGG - Exonic
1070268759 10:74931307-74931329 CAGTAGACACGGGTGGAAAGGGG - Intronic
1071325697 10:84514645-84514667 CAGGAGAGACAAGTGAAAAGGGG - Exonic
1071425655 10:85546584-85546606 GAGGTGGCACAGGGGGACAGGGG + Intergenic
1074232289 10:111549499-111549521 CAGGACACAGAGGTGGTCAGAGG - Intergenic
1074250698 10:111743330-111743352 CAAGAAACTCAGGTGGATAGAGG - Intergenic
1074409931 10:113219571-113219593 AAGGCCACACAGGTAGACAGAGG + Intergenic
1075515095 10:123102285-123102307 CAGGTGACATTGGTGGAGAGTGG + Intergenic
1075820588 10:125305181-125305203 AAGGAAACGCAGGTGGACAAAGG + Intergenic
1076014117 10:127014070-127014092 CAGGAGGCGCATGTGGACAGAGG - Intronic
1076250476 10:128980387-128980409 CAGGAGAGACATGGGCACAGAGG + Intergenic
1076462716 10:130657294-130657316 CAGGGGACACAGGTGCTCAGGGG + Intergenic
1076462720 10:130657311-130657333 CAGGGGTCACAGGTGCTCAGGGG + Intergenic
1076766211 10:132635064-132635086 CAAAAGCCACAGGTGGCCAGTGG - Intronic
1076813578 10:132902207-132902229 CTGGAGTCTCAGGAGGACAGAGG - Intronic
1076921284 10:133455953-133455975 CTGCAGACCCAGGAGGACAGGGG + Intergenic
1077087938 11:763953-763975 CAGGAGCCACAGCTGGGCAGTGG - Intronic
1077143246 11:1034057-1034079 CCGGAGACACAGGTGTCCAGCGG - Intronic
1077391623 11:2303066-2303088 CAGGAGCCAGAGGTGGTCAGGGG + Intronic
1078338325 11:10481491-10481513 CAGGAGACACAGGAGGAGTTAGG - Intronic
1079755476 11:24254147-24254169 TAGGAGACAAAGGTGAACCGAGG - Intergenic
1081591495 11:44426351-44426373 CTAGAGTCCCAGGTGGACAGGGG - Intergenic
1083490953 11:63014806-63014828 CGGGCGACAGTGGTGGACAGGGG + Exonic
1083650714 11:64202978-64203000 AAGGACACACAGGTAGACAAAGG - Intronic
1083704733 11:64506084-64506106 CAGGAGAACAAGGTTGACAGGGG - Intergenic
1084608535 11:70186472-70186494 CAGGACAGACAGGAGGGCAGTGG + Intronic
1084690581 11:70723376-70723398 AAGGAGACACAGGTGGCCTCTGG + Intronic
1084697308 11:70763337-70763359 CAGGGGACACAGGGGCACAGAGG + Intronic
1084711374 11:70845979-70846001 CTGGAGAAACAGGTGGCCAAGGG + Intronic
1084892831 11:72244742-72244764 CAAGAGATACAGGTACACAGAGG + Intronic
1085051836 11:73383976-73383998 CTGGAAACACAGCTGGACACAGG - Intronic
1085389514 11:76175402-76175424 GAGGAGACAGAGGTGCAGAGGGG + Intergenic
1086338771 11:85826230-85826252 CAGGATGCACAGGAGGACTGAGG + Intergenic
1087726086 11:101719000-101719022 CAGGAGTCCCAGGTGCAGAGGGG - Intronic
1087954716 11:104271383-104271405 TAGGAGACACAGGTGGTAACTGG - Intergenic
1088828484 11:113515662-113515684 CAGGAGGCAGGGGTGGCCAGGGG - Intergenic
1088987521 11:114922895-114922917 CAGGAAACAAAGATGGAAAGTGG + Intergenic
1089010391 11:115127488-115127510 AAGGGGACACAGGTGGGGAGTGG - Intergenic
1089127061 11:116183991-116184013 CTGGTGTCACAGCTGGACAGAGG + Intergenic
1089156186 11:116404544-116404566 GAGGAGAACCAGATGGACAGGGG + Intergenic
1089812115 11:121140757-121140779 CAGAAGACACAGAGGGAAAGAGG - Intronic
1091191032 11:133695419-133695441 CAGGAGTCACAGGACGTCAGAGG - Intergenic
1091877795 12:3950838-3950860 CAGGAGAGACAACTGAACAGAGG + Intergenic
1091957143 12:4655355-4655377 CAGTAGCCACATGTGGCCAGTGG - Intronic
1091998909 12:5017370-5017392 TATCAGACACAGGTGGATAGAGG + Intergenic
1092388581 12:8054950-8054972 CAGAAGACACAGATGAACAAGGG - Exonic
1094523828 12:31218998-31219020 CAGAAGAGACAGGTGGGTAGAGG - Intergenic
1095434631 12:42174001-42174023 CAGGAAACAAAGGAGGTCAGTGG - Intronic
1096812951 12:54183287-54183309 CAGAAGAGACTGGTTGACAGGGG - Intronic
1097189991 12:57214995-57215017 GCGGAGAGACAGGGGGACAGAGG + Intergenic
1097346358 12:58497883-58497905 CAGGAAACTGAGGTGGAGAGTGG + Intergenic
1098882004 12:75926591-75926613 CTGGTCACACATGTGGACAGAGG - Intergenic
1099281044 12:80646585-80646607 CAGGAGACACTCGAGGAGAGTGG + Intronic
1100726009 12:97409393-97409415 CAAGAGACAAACGTGTACAGAGG - Intergenic
1102454516 12:113063396-113063418 CAGTTCACACAGCTGGACAGAGG + Intronic
1103386035 12:120533507-120533529 CAGGAGACAGAGGCGGAAACAGG - Intronic
1104287611 12:127439350-127439372 CAGGAGACCCAGGTGTGCAGTGG - Intergenic
1104461756 12:128962129-128962151 CAGGAGGCCGAGGGGGACAGGGG - Intronic
1104631807 12:130408970-130408992 CAGAGGACACATGTGCACAGAGG - Intronic
1106095058 13:26636445-26636467 CAGGAAACACAAGGGGTCAGGGG - Intronic
1107360334 13:39610865-39610887 AAGGAGACAGAGATGGAGAGAGG + Intergenic
1107845919 13:44512513-44512535 TAGGAGAAACAGGTTTACAGAGG - Intronic
1108343277 13:49518690-49518712 CAGGTTACACAGCTGGTCAGTGG + Intronic
1108396355 13:49995694-49995716 CAGGAGACGGATGTGGCCAGGGG + Intergenic
1108525272 13:51280843-51280865 CAGGAGACAGACGTGGACACAGG + Exonic
1108570387 13:51743906-51743928 TAGGAAATACAAGTGGACAGAGG + Intronic
1110423691 13:75341138-75341160 CAGAAGACACACGTGCACATCGG - Exonic
1112563003 13:100530120-100530142 CTGGAGACACAGTTGGAGAAGGG + Exonic
1113056398 13:106272545-106272567 CAGGAAGCGCATGTGGACAGAGG - Intergenic
1113778709 13:112963539-112963561 CTGGAGACACAGGTGCAGGGAGG - Intronic
1113919940 13:113901573-113901595 CAGGAGAAAAGGCTGGACAGGGG - Intergenic
1114254306 14:20988752-20988774 GAGGAGACATGGGTGGACAGGGG - Intergenic
1117323592 14:54648069-54648091 CAATAGCCACATGTGGACAGTGG + Intronic
1117345731 14:54830281-54830303 CAAGAGATAAAAGTGGACAGTGG + Intergenic
1117931689 14:60849659-60849681 CACTAAGCACAGGTGGACAGTGG + Intronic
1119168647 14:72516028-72516050 CAGGAGAACCAGGTTCACAGAGG - Intronic
1119200833 14:72751557-72751579 CAGTAGCCACAGGTGGCTAGTGG - Intronic
1120103139 14:80466842-80466864 CAGGAGACACAGGAGTATATTGG + Intergenic
1121254414 14:92520602-92520624 CTGGAGAGAGGGGTGGACAGAGG + Intronic
1121313989 14:92950290-92950312 GAGGAGCCCCAGGTGGGCAGGGG + Intronic
1122397224 14:101442009-101442031 CAGGAGACGCAGGTGGCGGGGGG - Intergenic
1122860248 14:104579315-104579337 CAGGACTCACAGGGGCACAGGGG + Intronic
1123097453 14:105773241-105773263 GAGCAGCCACAGGTGAACAGGGG - Intergenic
1124368669 15:29091084-29091106 TCTGAGAGACAGGTGGACAGGGG + Intronic
1125195291 15:37039020-37039042 CATGTGACACAGATGGAGAGTGG + Intronic
1126832010 15:52617248-52617270 AAGGAGACACATGTGGCCTGGGG - Intronic
1127987961 15:64089439-64089461 CAGGAGGCAGAGGTTGAGAGCGG + Intronic
1128388427 15:67166592-67166614 CGGGAGTCAGAGGTGGACAGGGG + Intronic
1128429031 15:67573381-67573403 CAGGAGAGACAGTTGGGTAGAGG + Intronic
1128677881 15:69625053-69625075 CTCTGGACACAGGTGGACAGTGG + Intergenic
1128690709 15:69722845-69722867 GAGGACACACAGCTGGAAAGGGG - Intergenic
1128752509 15:70159444-70159466 CATGAGACAGGGGTGGTCAGGGG - Intergenic
1128988294 15:72237157-72237179 GGGCAGACACAGGTGGAGAGTGG - Intergenic
1129490746 15:75923095-75923117 CAGGATGCTCAGGTGGACAGAGG - Intronic
1130886445 15:88096477-88096499 CAGGAGACTCAGGTGGGCCAGGG - Intronic
1131868674 15:96738833-96738855 CAGGGGAGATAGGTGGAAAGGGG + Intergenic
1132866002 16:2093085-2093107 CAGGAGGCTCTGGTGGACGGGGG + Exonic
1133456641 16:5948046-5948068 CAGGAGAGGCAGGTGCACAAGGG + Intergenic
1134079856 16:11317206-11317228 CAGGAGACACAGCTGGAAGGAGG + Intronic
1134097073 16:11424972-11424994 AAGGAGACACAGGTGTGCCGGGG + Intronic
1135060835 16:19270139-19270161 CAGGGGAGCCAGGTGGACTGAGG + Intergenic
1135817017 16:25643923-25643945 CAGGAATCACAGGCAGACAGAGG + Intergenic
1136081402 16:27854630-27854652 CAGGTGACACAGGTGGGCACAGG - Intronic
1136461879 16:30416570-30416592 CAGGTGACAGAAGTGGACGGTGG - Intronic
1136856219 16:33660785-33660807 CAGGAGGCACTGATTGACAGGGG - Intergenic
1137486707 16:48897262-48897284 CAGGAGAAACAGGAGGTAAGTGG + Intergenic
1137529036 16:49265107-49265129 CAGGAGAAAAAGGTGGGAAGGGG + Intergenic
1138036082 16:53608074-53608096 CAGGAGAAAGAGGTGGGAAGAGG - Intronic
1138099910 16:54244291-54244313 CAGAAGAGACAGGCGGATAGAGG + Intergenic
1138490848 16:57375655-57375677 CAGGACACACAGCTGGGCAATGG + Intronic
1138497093 16:57415427-57415449 CAGGTCACACAGCTGGTCAGGGG + Intronic
1138712698 16:58986965-58986987 CAGGAGGCACATGTGGGCACTGG - Intergenic
1139347643 16:66314514-66314536 CAGGGGTCACAGGTGGGCATGGG + Intergenic
1140211681 16:72975465-72975487 CAGGAGAGAGGGGTGTACAGGGG + Intronic
1140695115 16:77525152-77525174 CAGGAAACACAAGTGGTCAGGGG + Intergenic
1140718993 16:77753572-77753594 CAGGTGCTACAGGTGGAAAGGGG - Intergenic
1141178759 16:81738316-81738338 CAGGAAATACAGGTGGGGAGAGG - Intergenic
1141326529 16:83065137-83065159 CAGGAGACAAAGGTGGCCAGTGG - Intronic
1141381027 16:83577232-83577254 CAGTGGACACAGTAGGACAGGGG - Intronic
1141388990 16:83648763-83648785 CAGGAGACAGAGATGGGGAGAGG - Intronic
1141601795 16:85131172-85131194 CAGAAGACACATGTGGAAACAGG + Intergenic
1141649564 16:85385782-85385804 GTGGAGACAGAGCTGGACAGGGG + Intergenic
1141699098 16:85634324-85634346 CAGGAGAGACAGAAGCACAGAGG - Intronic
1141802302 16:86318333-86318355 CAGGAGACACAGTTGGAGATAGG - Intergenic
1142026676 16:87818136-87818158 CAGCGGACACAGCTGGAGAGCGG + Intergenic
1142128185 16:88420476-88420498 CAGGAGGCCCAATTGGACAGTGG + Intergenic
1142253478 16:89002996-89003018 CAGAAGACCCGGGGGGACAGAGG + Intergenic
1203117806 16_KI270728v1_random:1509263-1509285 CAGGAGGCACTGATTGACAGGGG - Intergenic
1142683986 17:1566723-1566745 CAGGAGAAACAGGAAGAGAGAGG - Intergenic
1142883550 17:2898665-2898687 CAGAAGGCAGAGGTGGACGGGGG - Intronic
1144742205 17:17590313-17590335 CAGGAGGCACAGGAGGAGATGGG - Intronic
1144938440 17:18918741-18918763 CAGGAGCCACATGTAGCCAGTGG - Intronic
1144969180 17:19096467-19096489 CAGGTCACACAGCTGGAAAGTGG + Intronic
1144978736 17:19155599-19155621 CAGGTCACACAGCTGGAAAGTGG - Intronic
1144989486 17:19222633-19222655 CAGGTCACACAGCTGGAAAGTGG + Intronic
1145294411 17:21576312-21576334 CCTAAGACACAGGTGGACACAGG - Intergenic
1145369421 17:22296868-22296890 CCTAAGACACAGGTGGACACAGG + Intergenic
1146006667 17:29164822-29164844 CAGGAGGCACAGGAGCAGAGAGG - Intronic
1146629937 17:34462664-34462686 TGGGAGACACAGGTGGGCTGGGG - Intergenic
1146887982 17:36485178-36485200 CAGGACAGGCAGGTGGCCAGAGG + Intergenic
1147299825 17:39517455-39517477 CAGGCCACACAGCTGGACAAGGG - Exonic
1147325800 17:39668863-39668885 GAGGAGAGAGAGGTGGAGAGAGG + Intronic
1147460023 17:40562438-40562460 CAGGAAGCACTGGTGGCCAGTGG - Intronic
1147918779 17:43903973-43903995 CATGTGCCAGAGGTGGACAGGGG - Intronic
1148132445 17:45270356-45270378 CAGAAGACAGAGGTGGACAGAGG - Intronic
1148159251 17:45440875-45440897 CAGGGGCCACAGGAGGGCAGAGG - Intronic
1148876867 17:50693059-50693081 GAGGAGGCTCAGGTGGAGAGAGG + Intergenic
1148983462 17:51599602-51599624 CAGGACACACTGGTGGAAGGGGG - Intergenic
1149032269 17:52097736-52097758 AAGGAGACACAGTTTGATAGAGG + Intronic
1149564816 17:57633599-57633621 GAGGAGGCACCAGTGGACAGTGG + Intronic
1150107456 17:62472770-62472792 CAGGAGAGACAGGTGGACCTGGG + Intronic
1150390589 17:64787959-64787981 CAGGGGCCACAGGAGGGCAGAGG - Intergenic
1150516525 17:65816435-65816457 CAGGAGAAAAAGGTGGGAAGGGG - Intronic
1150553996 17:66237263-66237285 CAGCAAACAAAGGTGGAGAGTGG + Intronic
1151759874 17:76094584-76094606 GAGGAGACACAGAGGGATAGAGG + Intronic
1152235146 17:79134793-79134815 CAGCAGCCACCGGTGGACACTGG + Intronic
1152693421 17:81732132-81732154 CAGGAGACAAAGGAGAACATGGG + Intergenic
1155239411 18:23851275-23851297 CAGGAGACGAAGGACGACAGAGG - Intronic
1156414311 18:36871823-36871845 CAGCAGACACAGCTGGAAATGGG + Intronic
1156457113 18:37301058-37301080 CAGGAGACACAGGAGGAGGCAGG + Intronic
1156461390 18:37323224-37323246 AAGGAGGCACAGGTAGCCAGAGG + Intronic
1157475793 18:48022643-48022665 CAGGAGACACTGGTGGAGAGGGG + Intergenic
1158556682 18:58480912-58480934 CAGGAGACTCAAGTGGAATGAGG + Intergenic
1160107022 18:75987668-75987690 CAGGAAACATAGTTGGCCAGTGG + Intergenic
1161055818 19:2190216-2190238 CACGAGACACAGCAGGACCGGGG - Intronic
1161060769 19:2213739-2213761 CCTGGGACACAGCTGGACAGAGG - Intronic
1161342857 19:3752496-3752518 CAGGAAACTCACGCGGACAGCGG + Exonic
1163488137 19:17601651-17601673 CACGAGACAGGGGTGGACAGGGG + Exonic
1163566964 19:18057719-18057741 CGGGAGACTGAGCTGGACAGAGG - Intergenic
1163637442 19:18443830-18443852 CAGGACCCACAAGTGGACAGAGG + Exonic
1163717210 19:18879500-18879522 TAGTAGAAACAGGTGGGCAGAGG - Intronic
1163721582 19:18900450-18900472 CTGGAGACACAGGCAGACACGGG + Intronic
1164500769 19:28818212-28818234 CAAGAGACACAAGTAAACAGAGG + Intergenic
1164847618 19:31448167-31448189 CAGTAGCCACATGTGGCCAGTGG + Intergenic
1165114006 19:33518185-33518207 CAGGAGACAGAGGTGCAAGGTGG - Intronic
1165326128 19:35115525-35115547 CAGGAGACAGGGGAGGAAAGGGG + Intergenic
1165846060 19:38818398-38818420 CTGGGGACACAGGTGGAAACAGG - Intronic
1165855324 19:38876516-38876538 CAGGGGTCAGAGGTGGGCAGTGG + Intronic
1165990930 19:39813135-39813157 CAGGAGCCACATGTGGCCAGTGG + Intergenic
1166374667 19:42320949-42320971 CAGGACACAAAGTTGGAGAGGGG - Intronic
1166720447 19:44993094-44993116 CTGGAAACACAGAGGGACAGAGG - Exonic
1166777382 19:45321478-45321500 CAGGAGACAGAGGTCCAGAGAGG - Intronic
1166946865 19:46402751-46402773 CAAGAGCCACACGTGGCCAGTGG + Intergenic
1166959909 19:46491138-46491160 CAAGAGCCACACGTGGCCAGTGG - Intronic
1167213071 19:48145721-48145743 CAGGCCACACAGGTGGGGAGTGG - Intronic
1167221737 19:48203859-48203881 CAGGAGATACAGGTGGCCAATGG - Intronic
1167601401 19:50457063-50457085 AAGGACACACAGTTAGACAGTGG - Intronic
1167647730 19:50714932-50714954 CAGGAGCCACACTTGGCCAGTGG + Intronic
1168286460 19:55337133-55337155 GAGGAGACAGAGGTGGACAGAGG - Intergenic
1168522492 19:57063400-57063422 GAGGCAACACAGGTGGACACGGG + Intergenic
925162311 2:1694512-1694534 CAGGAGGGCCAGGTGGGCAGAGG - Intronic
925190229 2:1876487-1876509 CAGGAGCCCCAGATGGACGGGGG - Intronic
925438213 2:3859926-3859948 CAGAAGACAAAGGAGGAAAGAGG + Intergenic
925749803 2:7077796-7077818 CAGCAGGCTCAGGTGGTCAGTGG + Intergenic
925900934 2:8508953-8508975 CAGCAGGGACAGGTGCACAGGGG + Intergenic
926326906 2:11792871-11792893 GAGGAGACCCAGGTGGACACAGG - Intronic
926899985 2:17740245-17740267 TAGGAGAAACAGATGGACAAGGG - Intronic
927706238 2:25298159-25298181 AAGGTTACACAGGTGGTCAGTGG + Intronic
928113280 2:28527248-28527270 CAGGAGTCCCAGCTGGCCAGAGG + Intronic
928142164 2:28739308-28739330 CAGGATTCACAGGGGGACAAAGG - Intergenic
929053617 2:37857764-37857786 CAGGACACAAAGGAGAACAGGGG + Intergenic
929107290 2:38377359-38377381 GAGGAGATACAGGCGGAGAGCGG - Intergenic
930265980 2:49199542-49199564 CAGGGGACACAGAGGGACAATGG - Intergenic
931759708 2:65406032-65406054 CAGGTCACACAGTTGGATAGTGG - Intronic
932435402 2:71700210-71700232 CAGGAGCCAGAGGTGGACCCGGG + Intergenic
933844575 2:86315017-86315039 CAGGAGACCAAGGAGGAAAGAGG - Intronic
934516999 2:94994516-94994538 CAGGAGATGCAGCTGGACATAGG - Intergenic
934987749 2:98899970-98899992 GAGGGGACACAGATGGACAGAGG + Intronic
935404401 2:102693653-102693675 GAGGAGACACTGGTGGGCAGTGG - Intronic
935588701 2:104825310-104825332 CAGGTGTCACTGCTGGACAGAGG + Intergenic
935718599 2:105960249-105960271 CAGGGGACAAAGGTGGACTCAGG - Intergenic
935728639 2:106046311-106046333 CAGGAGAAAGAGTTGGCCAGAGG - Intergenic
936119211 2:109726841-109726863 CAGGAGATCCCAGTGGACAGAGG + Intergenic
937198063 2:120177658-120177680 CAGGAGACACTGCTGAACAGAGG + Exonic
938071474 2:128310646-128310668 TAGGATCCACAGGTGGGCAGAGG - Intronic
938132817 2:128732063-128732085 CTGGAGACACAGAAAGACAGAGG + Intergenic
938150215 2:128875919-128875941 GAGGAGACTTAGGTGGACACAGG + Intergenic
938594829 2:132777314-132777336 CAAGAGACACAGGGGGAAAAGGG + Intronic
939088457 2:137750094-137750116 CAGGACCTACAGGTTGACAGGGG - Intergenic
939547332 2:143569564-143569586 CAGGACACACAGAAGGCCAGAGG + Intronic
939689867 2:145244856-145244878 CAAAAGACCCAGATGGACAGAGG - Intergenic
940007616 2:149022367-149022389 CAAAAGACACATGTGGATAGTGG - Intronic
940036051 2:149313026-149313048 CTTGAGTTACAGGTGGACAGAGG - Intergenic
940437286 2:153669728-153669750 CAGGAAGCACAAGGGGACAGGGG + Intergenic
940867200 2:158829352-158829374 CAGGAGACACAGCTGCAAAAGGG + Intronic
941291175 2:163677434-163677456 CACTAGACACATGTGGCCAGTGG - Intronic
941714014 2:168745066-168745088 TATGAGACACAGGTGGGAAGTGG + Intronic
941945356 2:171090934-171090956 CAGTAGCCACATGTGGCCAGTGG + Intronic
942160156 2:173176635-173176657 CAGGAGACTAAGAAGGACAGGGG + Intronic
942328732 2:174798920-174798942 CAAGCCACACAGGTGGCCAGTGG + Intergenic
942508821 2:176673845-176673867 CAGGTGACACGGGGTGACAGTGG - Intergenic
942619780 2:177834510-177834532 CAGGACAGACAGGTGAGCAGTGG + Intronic
944987169 2:205190607-205190629 CAGGTCACACAGCTGGCCAGGGG - Intronic
945045224 2:205775994-205776016 GAGGAAACAGAGGTGGAGAGAGG - Intronic
945772643 2:214063480-214063502 CAGGAGAAACAGGTCAACAATGG + Intronic
945992033 2:216404142-216404164 CAGGTGAGACAGAGGGACAGAGG + Intergenic
946994215 2:225372564-225372586 CAGCAGCCACATGTGGCCAGTGG - Intergenic
947443654 2:230145473-230145495 AAGGAGTCACAGGTGGGTAGGGG + Intergenic
947606155 2:231487133-231487155 CAGGTGTCACAGGTGCACAGAGG + Intergenic
948046555 2:234950676-234950698 CAGGAGACACAGGTGGACAGAGG - Intergenic
948122322 2:235540053-235540075 CAGGATGGACAGATGGACAGTGG + Intronic
948595190 2:239075443-239075465 CAGGAGAAATGGGTGGAAAGAGG + Intronic
948701520 2:239763611-239763633 CAGGTGACAGAGGTGGAGAGAGG + Intronic
948819210 2:240530034-240530056 AAGGAGAAAGAGGGGGACAGAGG + Intronic
1170815012 20:19706470-19706492 CAGGACAAGCAGGTGGAGAGAGG + Intronic
1170884609 20:20329353-20329375 CAGGACAGAGAGGTGAACAGGGG - Intronic
1171199761 20:23231676-23231698 GAGGAGAGACAGGAGGGCAGAGG - Intergenic
1172132823 20:32667100-32667122 CAGCAGCCACAGATGGTCAGTGG + Intergenic
1173170068 20:40716587-40716609 CAGGAGTCAGAGGTGGCCAGGGG - Intergenic
1173346143 20:42201888-42201910 CAGTAGAGAAAGGTGGAAAGGGG + Intronic
1173454841 20:43193496-43193518 CAGTAGCCACAGGTGGCCAGTGG + Intergenic
1173532403 20:43780465-43780487 AAGGACACACAGCTGGAAAGTGG + Intergenic
1173539168 20:43838505-43838527 CAGGCCACAAAGGTGGGCAGAGG - Intergenic
1173554903 20:43959013-43959035 CTGGAGACCCAGGAGGGCAGTGG - Intronic
1173754180 20:45500295-45500317 CAGGGGGCAAAGGTGGAAAGGGG + Intergenic
1173839236 20:46146373-46146395 CAGGGGTCCCAGGTTGACAGGGG - Intergenic
1174107987 20:48176623-48176645 CTGGGGACAGAGGTAGACAGTGG - Intergenic
1174596345 20:51687123-51687145 CAGGTGACATGGGTGGAAAGTGG + Intronic
1175748224 20:61476572-61476594 GGTGAGACACAGGTGGAGAGTGG + Intronic
1175790950 20:61739425-61739447 CGGGAGACACGGGAGGACATGGG + Intronic
1175840746 20:62025593-62025615 CAGGAGAGACAGGAGGGCAGAGG - Intronic
1176041512 20:63068401-63068423 AAACAGACACAGGTGGGCAGAGG - Intergenic
1176098098 20:63353390-63353412 GAGGAGACACAGGAGAACATGGG + Intronic
1176189181 20:63799710-63799732 CAGCAGGCACACATGGACAGAGG + Intronic
1176191991 20:63815905-63815927 CAGTGGACACAGGTGGGCACAGG + Intronic
1176253362 20:64137772-64137794 CAGGTCACAGAGGTGGAAAGTGG + Intergenic
1177079450 21:16620246-16620268 CAGTAGACACATGTGGCTAGTGG - Intergenic
1178381357 21:32112299-32112321 AAGGACACACAGCTGGGCAGTGG - Intergenic
1178671190 21:34592985-34593007 CAGAAGACCCATGAGGACAGTGG + Intronic
1178929821 21:36807561-36807583 CAGGGGACAGAGCTGAACAGTGG - Intronic
1179680913 21:43020777-43020799 CAGGAGGCACAGGTGGGAACAGG + Intronic
1180185633 21:46137830-46137852 CAGGGGCCACAGCTGGGCAGAGG - Intronic
1180252201 21:46597136-46597158 CAGCATCCCCAGGTGGACAGGGG - Intergenic
1181062007 22:20286088-20286110 CAGGGGACTCTGGTGGGCAGTGG + Intergenic
1181139388 22:20792878-20792900 CATGAGACACAGGATGAAAGTGG + Intronic
1181163286 22:20969988-20970010 CAGGACACACAGGAGCACAGAGG - Intronic
1182559609 22:31149411-31149433 CAGAAGACAGATGTAGACAGTGG - Intergenic
1182642942 22:31782981-31783003 CAGGAGGCAAAGGTGGTGAGAGG + Intronic
1182694305 22:32186212-32186234 CAGAAGGCAGAGGTGGACAGGGG - Intergenic
1183315026 22:37132346-37132368 GGGGAGACAGAGGTGGGCAGGGG - Intronic
1183508245 22:38220991-38221013 CACTGGACAAAGGTGGACAGGGG + Exonic
1183539107 22:38419389-38419411 CAGGAGCCCCAGGAGGCCAGAGG + Intergenic
1183540886 22:38428727-38428749 CAGGAGCCACATGTGGTCAACGG + Intronic
1183568685 22:38635441-38635463 CATGAGGCACAGCTGTACAGTGG + Intronic
1183792236 22:40081586-40081608 CAGGTGACAAAGCTGGAAAGTGG - Intronic
1183955430 22:41377571-41377593 TAGGAGACAGAGGTAGAGAGAGG + Intronic
1184294100 22:43512941-43512963 CAGGGGGGCCAGGTGGACAGAGG - Intergenic
1184903726 22:47464654-47464676 CAGGAGCCACAGGAGGCCACAGG + Intronic
1184947706 22:47815875-47815897 CAGGAGACTCAGGGGCAGAGAGG + Intergenic
1185094868 22:48800701-48800723 CAGCAGACACAGGTGGCTGGAGG + Intronic
1185118654 22:48952541-48952563 TAGGAGGCACAGGGAGACAGAGG + Intergenic
949207862 3:1461758-1461780 CAATAGCCACAGGTGGCCAGAGG + Intergenic
949811386 3:8010726-8010748 CAGTAGCCACATGTGGCCAGTGG + Intergenic
949954050 3:9252728-9252750 GAGGAGTCACAGGAGGGCAGCGG - Intronic
950404085 3:12793885-12793907 GAGGACAGAGAGGTGGACAGGGG - Intergenic
950421574 3:12902736-12902758 CAGGACAGCCAGCTGGACAGAGG + Intronic
950716254 3:14849751-14849773 ATGGAGAAACAGGTGCACAGAGG - Intronic
950739427 3:15038164-15038186 CAGTAGATACAGGTGGAAAGGGG - Intronic
950848986 3:16044019-16044041 CAGGAGAGGCAAGTAGACAGGGG + Intergenic
953704662 3:45221989-45222011 GAGGAGGCAGACGTGGACAGAGG + Intergenic
954009038 3:47618688-47618710 CAGTAGACAGAAGTGGAAAGGGG + Intronic
954379085 3:50210170-50210192 CTGGAGGAGCAGGTGGACAGAGG + Intronic
954387518 3:50252071-50252093 CAGAGGGCACAGGTGGTCAGGGG - Intronic
954840555 3:53507959-53507981 CATCAGACACAGCTGGAAAGGGG + Intronic
955133782 3:56195945-56195967 CAGGGGACAAAGGAGGCCAGGGG + Intronic
956231674 3:67023451-67023473 AAAGAGACAGAGGTGGGCAGTGG + Intergenic
956249461 3:67220536-67220558 TAAGAGACAAAGGTGGACACAGG - Intergenic
956620769 3:71219340-71219362 CAGTAGCCACATGTGGCCAGTGG - Intronic
957021046 3:75126469-75126491 CAGGAAACACAGGTAGAGAATGG + Intergenic
957607627 3:82423000-82423022 CAGGAGAGACTGGTGGGTAGCGG + Intergenic
958873455 3:99589055-99589077 CAGGAAACACAAGGGGTCAGGGG + Intergenic
961465672 3:127079605-127079627 CAGGAGACATAGATGGAGAGTGG + Intergenic
962033892 3:131630656-131630678 CAGGAGACATATGTGGCTAGGGG + Intronic
963707807 3:148710058-148710080 CAGTAGACACATGTGGTTAGTGG + Intronic
964567935 3:158077837-158077859 CAGGAGAGTCAGGGGGAAAGGGG + Intergenic
964771279 3:160226095-160226117 CAGGACTCACTGCTGGACAGTGG + Exonic
965727467 3:171733914-171733936 CAGGAAACAAAGGTGGAGAAAGG + Intronic
965834906 3:172840636-172840658 CAGGAGACACAGGGTGAAAGGGG - Intergenic
968009222 3:195262323-195262345 CAGGGGAGACAGGAGGACGGAGG + Intronic
968932834 4:3591484-3591506 CAGAAAAGACAGGGGGACAGAGG - Intergenic
969074401 4:4566478-4566500 AAGGAGTAGCAGGTGGACAGTGG - Intergenic
969153886 4:5193156-5193178 CAGGAGGCACGAGAGGACAGTGG - Intronic
969235180 4:5860502-5860524 AAGGAGACACAGCTGGGAAGTGG - Intronic
969332952 4:6490553-6490575 CCTGAGAAACAGATGGACAGGGG + Intronic
969689875 4:8698536-8698558 CAGGAGGCAGAGGAGGGCAGGGG + Intergenic
969709817 4:8836269-8836291 CAGGAAACACAGGTGGGGAATGG - Intergenic
970077772 4:12244375-12244397 CATGAGACAAAGTTGAACAGAGG + Intergenic
971055106 4:22903631-22903653 CACAATTCACAGGTGGACAGTGG + Intergenic
971765568 4:30826437-30826459 CTGGAGACTCAGTTGGACCGAGG - Intronic
971799222 4:31266833-31266855 CATGAGAAGCAGGTGTACAGTGG - Intergenic
972640096 4:40917376-40917398 CAGCAGAGACGGGTGAACAGTGG + Intronic
972657548 4:41079361-41079383 CAGGATACACAGGTAGAGATAGG + Intronic
972825677 4:42756672-42756694 CAGGAGAAAATGGTGGAAAGTGG - Intergenic
972843601 4:42960769-42960791 AAAGATACACAGGTGGCCAGTGG + Intronic
973536914 4:51892377-51892399 CAGTAGTCACATGTGGCCAGTGG + Intronic
973563597 4:52161935-52161957 CAGGAGACAGAGGAGAAAAGTGG - Intergenic
973623844 4:52751735-52751757 CAGTGGACACAGGTGGCCAATGG - Intergenic
974133597 4:57787387-57787409 CAGGAGGCAAAGGTGGAAACAGG + Intergenic
974540953 4:63234476-63234498 CAGGAGAATCAGTTGGACACGGG + Intergenic
975765626 4:77664561-77664583 CAAGAGAGAAGGGTGGACAGGGG + Intergenic
977242798 4:94593473-94593495 GAGGAGACACAGTGAGACAGTGG - Intronic
978529398 4:109699030-109699052 CAGTAGACACATGTGGCCAGTGG - Intronic
978591708 4:110330801-110330823 CAGGAGACAAAGGGGGAGAAGGG - Intergenic
982231179 4:153209539-153209561 TTGAAGGCACAGGTGGACAGTGG - Intronic
982673152 4:158346490-158346512 CACTAGTCACAGGTGGCCAGTGG + Intronic
984136498 4:175946725-175946747 CAGGCTACAGAGGTGGGCAGAGG + Intronic
985017558 4:185652332-185652354 GAGCAGACAGGGGTGGACAGAGG + Intronic
985521536 5:376119-376141 CAGAAGACCCAGGTGGACGCAGG + Intronic
985719898 5:1483340-1483362 ACAGAGACACAGGTGCACAGAGG + Intronic
985874888 5:2587066-2587088 TAGGAGGCACAGGGGGCCAGAGG - Intergenic
985887915 5:2694539-2694561 AAGGGGCCACAGGTAGACAGAGG + Intergenic
986249791 5:6045460-6045482 CAGGGGACACAGGAGGCCGGAGG - Intergenic
986331694 5:6721102-6721124 GAGGAGACTCAGGAGGGCAGTGG - Intronic
988800866 5:34695476-34695498 CAAGAGCCACATGTGGGCAGTGG - Intronic
989588355 5:43090682-43090704 CAGGAGGCACAGCTGGACTAGGG + Intronic
990268593 5:54107924-54107946 CAAGAAACACAGGTATACAGAGG + Intronic
990993356 5:61706954-61706976 CAGGAAATACAGGAGGAAAGAGG - Intronic
991034572 5:62115484-62115506 AAGGTCACACAGCTGGACAGTGG + Intergenic
991045619 5:62219295-62219317 CAGGAGGCACTGATTGACAGGGG + Intergenic
991369030 5:65899002-65899024 CAGGAGAATCAGGGGGGCAGAGG - Intergenic
995407988 5:111823396-111823418 CAGGAGACAGAGCTAGACTGGGG - Intronic
995595960 5:113748049-113748071 CAGAAGAGACAGGAAGACAGTGG + Intergenic
995651944 5:114379186-114379208 CTGGGGCCCCAGGTGGACAGTGG - Intronic
995657849 5:114446993-114447015 CAGTAGACACATGTGGCTAGTGG + Intronic
996972419 5:129387642-129387664 CAGGAGACTCACTTGAACAGGGG - Intergenic
997103974 5:130996987-130997009 AAGGAGTAGCAGGTGGACAGTGG + Intergenic
997360397 5:133291146-133291168 CAGGAGACACAGGAGGGGAGGGG + Intronic
997431647 5:133845012-133845034 GTGGAGACACAGGGGGACGGCGG - Intergenic
997891788 5:137683361-137683383 CAGGAGACACTGGCTGACACAGG + Intronic
998228464 5:140344680-140344702 AAGGTGATACAGGTGGTCAGAGG + Intronic
998334239 5:141356698-141356720 ATGGAGACATAGGAGGACAGAGG - Exonic
999018619 5:148137973-148137995 CAAGAGATACATGTGGATAGAGG + Intergenic
999818293 5:155199566-155199588 ACTGAGACACAGGAGGACAGAGG - Intergenic
1000026633 5:157364227-157364249 CAGGAGACACTCGGGGACTGAGG - Intronic
1000536558 5:162485530-162485552 CAGAAGACTAAGGTGGAGAGAGG + Intergenic
1001572393 5:172738657-172738679 TAGGAGGTACAGGTGGATAGGGG + Intergenic
1002204502 5:177553764-177553786 CAGGAGACACAGCTGCTGAGGGG + Intronic
1002790580 6:434768-434790 CTGGACACACAGGTGGAGGGAGG - Intergenic
1003116077 6:3284680-3284702 CATGAGTCAAAGGGGGACAGCGG + Intronic
1003488158 6:6597313-6597335 CAGGAGCTCCAGGTGGACAGAGG + Intronic
1003516610 6:6823799-6823821 CAAGAGACAGAGGGGGACAGAGG + Intergenic
1003689319 6:8337119-8337141 CAGGATGCACCGGTGGAAAGAGG - Intergenic
1005518276 6:26575142-26575164 CAGGAGACACTGGGCGGCAGAGG - Intergenic
1005591355 6:27331569-27331591 CTGGGGTCATAGGTGGACAGAGG - Intergenic
1005836014 6:29710228-29710250 CAGGAAGCACAGGTGTCCAGTGG - Intergenic
1005850076 6:29814481-29814503 AAGGAAACACAGGGAGACAGGGG + Intergenic
1006443050 6:34063838-34063860 CTGGGGAGACAGATGGACAGAGG + Intronic
1006854443 6:37123420-37123442 CAGAAGCCAGAGGAGGACAGGGG + Intergenic
1007722126 6:43891280-43891302 AAAGAGAAACAGGTGGACAGAGG - Intergenic
1007736256 6:43984107-43984129 GAGGAGACACAGAGAGACAGAGG - Intergenic
1008064156 6:47029832-47029854 CAGGGGCCACATGTGGCCAGGGG + Intronic
1008481616 6:51992042-51992064 CAGGACCCACAGCTGGAAAGTGG - Intronic
1010168351 6:72943633-72943655 GAGGAGACACAGTGGCACAGAGG + Intronic
1012536092 6:100298685-100298707 CAGGAGGCAGAGGTGGTGAGCGG + Intergenic
1013466112 6:110418449-110418471 CAGGAGAGAGAGGAGTACAGTGG + Intergenic
1015228483 6:130886046-130886068 GAGGAGCTACAGATGGACAGAGG - Intronic
1018199859 6:161384637-161384659 CTGGAGACACAGGGGAACAGAGG + Intronic
1018442182 6:163823525-163823547 CCTGAGACAGAGCTGGACAGAGG + Intergenic
1018936295 6:168276039-168276061 CAGGGGACCCAGGTCTACAGGGG - Intergenic
1019123876 6:169826142-169826164 CATCTGACACAGGTGGACACAGG - Intergenic
1019186701 6:170224699-170224721 CAGGAGGCAGGGGTGGTCAGTGG - Intergenic
1019321240 7:416286-416308 CAGAACACAGGGGTGGACAGGGG - Intergenic
1019381481 7:726546-726568 CCGGCGACAGAGGGGGACAGCGG + Intronic
1019423829 7:963862-963884 CCGGAGAGACAGGAGCACAGGGG + Intronic
1019478330 7:1254800-1254822 GAGGACACACAGCTGGGCAGGGG + Intergenic
1020334876 7:7055440-7055462 CAGGAGTCACATGTGGCTAGTGG - Intergenic
1021968614 7:25946382-25946404 CAAGACACACAGCTAGACAGTGG - Intergenic
1022412245 7:30148376-30148398 CAGGAGTCACAGAAGGACATGGG + Intronic
1022849606 7:34246627-34246649 CAGTAGCCACATGTGGCCAGTGG + Intergenic
1023138534 7:37077757-37077779 GAGGAGCCACAGGTGGAGAGAGG + Intronic
1023303374 7:38797763-38797785 CAGGGGAAACAGGTTAACAGGGG + Intronic
1023892290 7:44401820-44401842 CAGAACACACAGGTGGAGACAGG + Intronic
1023970178 7:44985219-44985241 CAGTAGCCACAGGTGGCCAGTGG - Intergenic
1023983995 7:45084897-45084919 CAGAAGACAGAGGAGGAGAGCGG - Exonic
1025098747 7:56117531-56117553 CTGGGGCCACAGGTGGACACAGG - Intergenic
1025606805 7:63045184-63045206 GAGGAGGCAGAGGTGCACAGAGG + Intergenic
1026198848 7:68196461-68196483 CAGGAGGCAAAGGGGGACACAGG + Intergenic
1026199909 7:68205744-68205766 CATGAGAGACTGGTGGACACAGG - Intergenic
1027164600 7:75825461-75825483 CAGGAGAGCCAGGTGAACAGTGG + Intergenic
1027781918 7:82530650-82530672 CAGGAGAGACAAGTGGGGAGGGG - Intergenic
1028217078 7:88146816-88146838 CAGGAGACACAGTGGTAGAGTGG - Intronic
1028643927 7:93074263-93074285 CAGGAGACTGAGGTGGAGAATGG - Intergenic
1029480486 7:100809488-100809510 CAGGTGAAACTGGTGAACAGAGG - Intronic
1029506928 7:100968438-100968460 CAGGAGACACAGGTGCTCCCAGG - Intergenic
1030849338 7:114463382-114463404 CAGTAGCCACATGTGGATAGTGG - Intronic
1031973952 7:128082303-128082325 TGGTAGGCACAGGTGGACAGAGG + Intronic
1032036504 7:128525324-128525346 CAGGAGAGGCAGGTGGACCCGGG + Intergenic
1033538570 7:142334815-142334837 GAGCAGAAACAGATGGACAGTGG - Intergenic
1034225951 7:149482168-149482190 CAGTAGCTACAGGTGGATAGTGG + Intronic
1034265273 7:149777683-149777705 CAGGAGGCACAGGTGGCCGAGGG - Intergenic
1034301946 7:150024041-150024063 AAGGAGACAAAGGCAGACAGAGG + Intergenic
1034454866 7:151163460-151163482 CAGTAGCCACAGGTGAACAGTGG - Intronic
1034804102 7:154073274-154073296 AAGGAGACAAAGGCAGACAGAGG - Intronic
1035014735 7:155755285-155755307 CAGGACACACAGAAGGACAGGGG - Intronic
1035193188 7:157190494-157190516 CAGTAGCCACATGTGGCCAGGGG + Intronic
1035369469 7:158370082-158370104 CAGGAGAAACTGGTGCACGGCGG + Intronic
1035443220 7:158921311-158921333 GAGGAGACCACGGTGGACAGTGG + Intronic
1035475542 7:159141464-159141486 CAGTAGCCACAGGCGGCCAGCGG - Intronic
1036717846 8:11143441-11143463 CAGAAAACACAAGAGGACAGAGG + Intronic
1036778125 8:11627782-11627804 GAGGAGGCAGAGGTGCACAGAGG - Intergenic
1037891113 8:22624195-22624217 CAGGGGAGACAGGTGGGCAGGGG - Intronic
1038562350 8:28591262-28591284 AAGGAGAGAGAGGTGGGCAGGGG + Intergenic
1039445141 8:37625138-37625160 GAGGAGACACATGTGGGCCGTGG - Intergenic
1039905686 8:41784925-41784947 CAGGTCACACATGTGGTCAGTGG + Intronic
1041884905 8:62797496-62797518 CAGGAGACACAGGTAAACAATGG - Intronic
1042150807 8:65781468-65781490 CAGGGAACACAGGTAGACACAGG + Intronic
1042734198 8:71969371-71969393 CTTGAGAGACTGGTGGACAGTGG + Intronic
1042952835 8:74219381-74219403 CAGGAGATGCAGCTGGAAAGAGG + Intergenic
1046310538 8:112430831-112430853 CAAGAGAGACAGGTCAACAGAGG + Intronic
1047248637 8:123165549-123165571 CAGGGGTCACAGCTGGACTGTGG + Intergenic
1047498549 8:125425863-125425885 CACGAGAGATAGTTGGACAGAGG + Intergenic
1047766482 8:127994128-127994150 AAGGAGAGACAGTTGGAGAGGGG - Intergenic
1048512345 8:135074310-135074332 CAGTAGCCACATGTGGCCAGTGG + Intergenic
1048863244 8:138739457-138739479 GAGAAGACACAGTGGGACAGAGG - Intronic
1049149029 8:141022508-141022530 AAGGCGACACAGCTGGAGAGAGG - Intergenic
1049158045 8:141078827-141078849 CAGGGGGCACAGGTGGTTAGTGG + Intergenic
1049173496 8:141176810-141176832 CAGGACCCACAGGTGGCGAGAGG - Intronic
1049219097 8:141420737-141420759 GGGGGGACACTGGTGGACAGGGG + Intronic
1049463401 8:142740252-142740274 CAGGAGACACCAGGGGACTGGGG + Intergenic
1051828105 9:21244083-21244105 CAGGAAACACAGGTGAATAAAGG - Intergenic
1052170973 9:25396121-25396143 CAGGACACAGAGGTGGTAAGTGG - Intergenic
1053280785 9:36818738-36818760 GAGGAGAGACAGCTGGAGAGAGG - Intergenic
1054457294 9:65440411-65440433 CAGAAAAGACAGGGGGACAGAGG + Intergenic
1055717052 9:79129213-79129235 CAGGACACACAGAAGGACACAGG + Intergenic
1055768201 9:79687962-79687984 CAGGAGATGCTGTTGGACAGTGG + Intronic
1057216253 9:93230448-93230470 CAGGCCACACAGGTGGCCAGTGG + Intronic
1057498097 9:95575849-95575871 CAGGAAGCACAGGTGGAGTGGGG + Intergenic
1057865808 9:98679796-98679818 CTGAAGACACAGGAGCACAGAGG + Intronic
1057952885 9:99384161-99384183 CAGGAGACAATGCTGGAAAGGGG + Intergenic
1058478073 9:105361188-105361210 CAGGAGGCACAGGTGTACTATGG + Exonic
1058745952 9:107991037-107991059 CAGAAGACTGAGGTGGAGAGAGG - Intergenic
1059416983 9:114168410-114168432 CAGGGGACCCAGGGGGACTGTGG + Exonic
1059461330 9:114432320-114432342 CAGGAGCCCCAGGAGGAGAGGGG + Intronic
1059740216 9:117142854-117142876 CTGGAGACACAGATGGAGGGAGG - Intronic
1060533650 9:124365294-124365316 AAGGAGCCACAGATGGACACGGG + Intronic
1060994726 9:127869461-127869483 AAGGCCACACAGCTGGACAGAGG + Intronic
1060994740 9:127869539-127869561 CAGGTCACACAGCTGAACAGAGG - Intronic
1062262129 9:135667974-135667996 CAGGGGCCTCAGGTGGACAAAGG + Intergenic
1062447126 9:136599710-136599732 CAGGAGTCAGAGGTGGCCTGGGG + Intergenic
1062657551 9:137612082-137612104 CACAAGACCCAGGTGGGCAGGGG - Intronic
1062715155 9:138006470-138006492 CAGGAGAAGGAGGTGGGCAGAGG - Intronic
1186437710 X:9557371-9557393 CAGGGGAAACAGGCGGTCAGAGG + Intronic
1186438374 X:9563683-9563705 CAGTAGCCACATGTGGCCAGTGG + Intronic
1186817893 X:13255984-13256006 CAGGAGAAACTGGTGGAATGGGG - Intergenic
1186966211 X:14788758-14788780 CAAGAGCCACATGTGGCCAGTGG + Intergenic
1188263635 X:28043604-28043626 GATGAGGCACAGGTGGCCAGTGG - Intergenic
1188483959 X:30662085-30662107 CAGTAGCCACATGTGGCCAGTGG - Intronic
1189281811 X:39824422-39824444 CAGTAGTCACAGGTGGCTAGTGG - Intergenic
1189297601 X:39929920-39929942 CAGGACTCCCAGGTTGACAGTGG - Intergenic
1190248222 X:48704822-48704844 CAGGGGTCACAGGTGGGTAGGGG - Intronic
1190258833 X:48785659-48785681 AAGGAGACAGACGTGGAAAGAGG - Intergenic
1191157468 X:57289549-57289571 TAGGAGACAAGGGTGGAAAGAGG + Intronic
1191764488 X:64682365-64682387 CAGGGGACACAGGAGGAAGGGGG + Intergenic
1192196299 X:69031031-69031053 GAGGAGACAGAAGTGGAGAGAGG + Intergenic
1194267659 X:91775393-91775415 CAGTAGCCACATGTGGATAGTGG + Intergenic
1194397316 X:93402196-93402218 CATGAGATACAGGAGGCCAGAGG + Intergenic
1197062646 X:122199604-122199626 GAGGAGCCAAAGGTGGCCAGGGG + Intergenic
1197114267 X:122813982-122814004 CATGAGAAACAGGTGGACGGTGG - Intergenic
1198315660 X:135463750-135463772 CAGGAGCCACATGTGGTGAGTGG - Intergenic
1198385156 X:136122245-136122267 CAGGAGTCACAGATGCAAAGGGG - Intergenic
1198392592 X:136191239-136191261 GAGTAACCACAGGTGGACAGAGG - Intronic
1201056355 Y:9996012-9996034 CAGGAGACACGGGAGCACAGTGG - Intergenic