ID: 948048969

View in Genome Browser
Species Human (GRCh38)
Location 2:234964989-234965011
Sequence GGGTCACGGGAGCACTGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 405
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 378}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948048969_948048977 1 Left 948048969 2:234964989-234965011 CCAGCCCAGTGCTCCCGTGACCC 0: 1
1: 0
2: 2
3: 24
4: 378
Right 948048977 2:234965013-234965035 CATGTGGTACTTCTCCCTCCCGG 0: 1
1: 0
2: 1
3: 13
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948048969 Original CRISPR GGGTCACGGGAGCACTGGGC TGG (reversed) Intronic
900167642 1:1249931-1249953 GGGTCACGTGTCCACTGGACGGG + Intergenic
900177793 1:1298459-1298481 GGGTCACAGCAGCCCTGGGATGG - Intronic
900220312 1:1505204-1505226 GGGTCACGTGTCCACTGGACGGG + Intergenic
900316098 1:2057163-2057185 GGGCCTAGGGAGCACCGGGCAGG - Intronic
900471266 1:2856170-2856192 AGGTCAGGGGAGAGCTGGGCAGG + Intergenic
900554928 1:3275634-3275656 AGGGAACTGGAGCACTGGGCAGG - Intronic
900799639 1:4729256-4729278 GAGTGAGGGGAGCACAGGGCAGG + Intronic
900957210 1:5893408-5893430 GGGTCACGTGTCCACTGGACAGG + Intronic
900959888 1:5912170-5912192 GGGGCAGGGGAGCAATGGGATGG + Intronic
901041027 1:6363657-6363679 GGGTCACATGTGCACTGGACAGG - Intronic
902488479 1:16763711-16763733 GGGGCATGGGAGCCCAGGGCAGG - Intronic
902603609 1:17556279-17556301 GGGGCCTGGGAGCACAGGGCGGG + Intronic
902911681 1:19603031-19603053 GGGTCACAGAAGCACTAGGCCGG + Intronic
903538120 1:24080893-24080915 GGGTTATGGGAGCAGTGGGTAGG + Intronic
904587697 1:31589041-31589063 GGGTCCCGGGGCCACTGAGCGGG - Intergenic
905709028 1:40085306-40085328 GGGTCACGTGTCCACTGGACAGG - Intronic
905835618 1:41117806-41117828 GGGTCACGTGTCCACTGGACAGG - Intronic
905888376 1:41504004-41504026 GGGTCATGGAAGCACAGGGAAGG + Intergenic
906323017 1:44828259-44828281 GGGTCACGGGAGGAAGGGGCTGG + Intronic
906517480 1:46448215-46448237 CGGCCTCGGGAGCGCTGGGCAGG + Intergenic
907442964 1:54489703-54489725 GGGTCACGGTAGCCCTGCCCAGG - Intergenic
907515339 1:54990200-54990222 AGTTCACAGGAGCACTGGACAGG + Intronic
908168708 1:61483948-61483970 GGGGAAAGGGAGCCCTGGGCAGG + Intergenic
908774298 1:67625515-67625537 GGGTCACGGGAGGGAAGGGCAGG + Intergenic
908818570 1:68058666-68058688 GGGTCACGTGTCCACTGGACGGG - Intergenic
909455309 1:75843124-75843146 GGGTCACGTGTCCACTGGACAGG - Intronic
910208765 1:84773594-84773616 GGGTAGAAGGAGCACTGGGCTGG + Intergenic
910538517 1:88327827-88327849 GAGTCACAGGAGATCTGGGCAGG + Intergenic
911073477 1:93850513-93850535 GGGTCACGTGTCCACTGGACAGG + Intergenic
911958043 1:104262889-104262911 GGGTCACGTGTCCACTGGACAGG + Intergenic
913307188 1:117442113-117442135 GGTACACGGGAGCACAGGGTAGG - Intronic
915087339 1:153397584-153397606 GGGCATCGGGAGCACTGGGCAGG + Intergenic
915269845 1:154746271-154746293 GGGGCACGGGGCCACTGCGCAGG + Intronic
915481937 1:156192866-156192888 GGGTCACGTGTCCACTGGACAGG - Intergenic
916069132 1:161159783-161159805 GGGGCCTGGGAGAACTGGGCTGG + Intronic
916179295 1:162070052-162070074 GGGGCCTGGGAGCGCTGGGCAGG - Exonic
918036847 1:180881977-180881999 GGGGCAGGGGAGCACTGAGTGGG + Intronic
919630393 1:199954953-199954975 TGGTCTCGGGGGCACTGAGCAGG + Intergenic
920061440 1:203229567-203229589 GGGTCTCGGGAGCTGTGGGGAGG - Intronic
921263560 1:213404317-213404339 GGGGGATGGGAGCACTGGCCAGG + Intergenic
923531960 1:234818805-234818827 GGGGCAGGGGAGCCCAGGGCAGG + Intergenic
924527462 1:244864590-244864612 CGCTGACGGGAGCACTGCGCAGG + Intergenic
1063664880 10:8055188-8055210 GGGTCTCGGGTGCGCTGGGCGGG + Intronic
1064018838 10:11793380-11793402 GGGTCACGTGTCCACTGGACAGG - Intergenic
1065267910 10:23996391-23996413 TGGAAAGGGGAGCACTGGGCCGG + Intronic
1066653496 10:37680410-37680432 GGGACACGGGAGCACAGGACTGG - Intergenic
1067037878 10:42932953-42932975 GGGGCGCGGGAGCACAGGGCTGG - Intergenic
1068519224 10:58060874-58060896 GGCTACCTGGAGCACTGGGCTGG - Intergenic
1068523754 10:58105427-58105449 GGGTGACTGGACCACTGGGGAGG + Intergenic
1068917936 10:62452848-62452870 TGGTCACAGAAGGACTGGGCAGG + Intronic
1069861375 10:71473790-71473812 GGGTCAGGTGAGCAGTGGGCAGG + Intronic
1070793090 10:79201375-79201397 GGCACATGTGAGCACTGGGCAGG - Intronic
1072445099 10:95492587-95492609 GTGTTATGGGAGCACTGAGCAGG + Intronic
1072863259 10:99029547-99029569 GGGTCACGTGTCCACTGGACAGG + Intronic
1073593667 10:104779638-104779660 GGGCCAATGGATCACTGGGCAGG - Intronic
1074864744 10:117538058-117538080 GAGCCGCGGGAGCACAGGGCGGG + Intergenic
1076572328 10:131440938-131440960 GGGTCACGTGTGCATGGGGCCGG - Intergenic
1076732559 10:132445986-132446008 CGGGCACGGGAGCCCAGGGCTGG - Intronic
1076799632 10:132814629-132814651 GAGAAACGGGAGCACAGGGCGGG + Intronic
1076993961 11:289406-289428 GGGTGGGGGGAGCGCTGGGCGGG - Intronic
1077006738 11:361627-361649 GGGTCACGTGTCCACTGGACAGG + Intergenic
1077082420 11:729992-730014 GGGTAACGGGTGCCCCGGGCTGG - Intergenic
1077097337 11:804664-804686 GGCTCGCAGGAGCACCGGGCAGG + Intronic
1077479626 11:2807597-2807619 GGGTTGCGGAGGCACTGGGCGGG - Intronic
1077520122 11:3028183-3028205 GGGTCACGTGTCCACTGGACAGG - Intronic
1078360000 11:10660757-10660779 GGGGCACAGGAGGAGTGGGCTGG - Intronic
1081601909 11:44501207-44501229 TTGTCACAGGAGCCCTGGGCAGG + Intergenic
1081646401 11:44793438-44793460 GGGTCACTGGCACACTGGGAGGG - Intronic
1083349450 11:62017038-62017060 GGGTCACGTGTCCACTGGACAGG - Intergenic
1083427476 11:62595985-62596007 GAGTTACGGGGGCACTGGGATGG - Intronic
1083910601 11:65706996-65707018 GGGTCACGTGTCCACTGGACAGG - Intergenic
1084121433 11:67071387-67071409 CGGTGAAGGGGGCACTGGGCAGG - Intronic
1084322470 11:68381323-68381345 GTGTCACGGGAGCCCTCTGCAGG + Intronic
1084939361 11:72604123-72604145 GGGCCCAGGGAGCACTGGGCAGG - Intronic
1085386124 11:76159389-76159411 GTGTGTGGGGAGCACTGGGCAGG + Intergenic
1086329321 11:85737923-85737945 GGGTCACGGAGGCCCTGGGTGGG + Intronic
1088918446 11:114244376-114244398 GGGTCACAGGTGCACTGGGCAGG + Intronic
1089110972 11:116055761-116055783 GGGCCACGGGACCACTGTGGAGG + Intergenic
1089331329 11:117690975-117690997 GTGTCACGGGAGCCCTAGGGAGG - Intronic
1091180037 11:133596176-133596198 GGTTCTCGGGAGCGCTGGGGAGG - Intergenic
1091361300 11:134980530-134980552 GGCTGATGTGAGCACTGGGCTGG - Intergenic
1092224958 12:6742263-6742285 GGGTCACGTGTCCACTGGACAGG - Intergenic
1092444197 12:8538429-8538451 GGGTCACGTGTCCACTGGACAGG - Intronic
1092449061 12:8585091-8585113 GGGTCACGTGTCCACTGGACAGG - Intergenic
1094182386 12:27605395-27605417 GGGTAAGGGGAGCACTGTGAGGG + Intronic
1097089987 12:56497318-56497340 GGGTCACGTGTCCACTGGACAGG - Intergenic
1097090520 12:56500952-56500974 GGGTCACGTGTCCACTGGACAGG + Intergenic
1097591670 12:61582426-61582448 GGGTCACGTGTCCACTGGACAGG + Intergenic
1098935335 12:76472614-76472636 GGGTCACGTGTCCACTGGACAGG + Intronic
1100367477 12:93935076-93935098 GGGCCACAGGAGCAGTTGGCAGG - Intergenic
1100408313 12:94290503-94290525 GGGTGGGGGCAGCACTGGGCAGG - Intronic
1101434687 12:104654645-104654667 AAGTCTCTGGAGCACTGGGCTGG - Intronic
1102306942 12:111812024-111812046 GGGTCACGTGTCCACTGGACAGG + Intergenic
1102585592 12:113920565-113920587 GGGCCACGGAGGCACTTGGCAGG - Intronic
1103357999 12:120336047-120336069 GGGTCACGTGTCCACTGGACAGG - Intergenic
1103702837 12:122856587-122856609 GTGTCACTGGGGCAGTGGGCTGG - Intronic
1104320149 12:127743063-127743085 GGGTCACAGGAGCAGTTGGGAGG + Intergenic
1104800527 12:131552441-131552463 GGGCCACAGGAGCAGTTGGCAGG + Intergenic
1105019905 12:132809093-132809115 GGGTCACGTGTCCACTGGACGGG + Intronic
1105020188 12:132811050-132811072 GGGTCACGTGCCCACTGGACAGG - Intronic
1105043125 12:132977491-132977513 GGGTCACGTGTCCACTGGACAGG - Intergenic
1106505882 13:30370133-30370155 GGGTCATGGGAGCTTTGGGAGGG - Intergenic
1113808645 13:113124137-113124159 GGGCCTCGGGAGCCCCGGGCCGG - Intronic
1113856742 13:113450610-113450632 GGGTCACGTGTCCACTGGACAGG + Intronic
1113880353 13:113622083-113622105 GGGTCACGCGTCCACTGGACAGG - Intronic
1115176066 14:30562890-30562912 GGGTCACGTGTCCACTGGACAGG - Intronic
1116313809 14:43360464-43360486 GGGTCAAGGCAGCAGGGGGCTGG + Intergenic
1117632552 14:57708851-57708873 GGGTCACGTGTCCACTGGACAGG + Intronic
1117895912 14:60486037-60486059 CGGTCCCCGGAGCCCTGGGCTGG + Exonic
1118752758 14:68818506-68818528 GGGTCATGGGGTCATTGGGCAGG - Intergenic
1119219408 14:72893732-72893754 GGGTCGCGGGAGCTCGGGGACGG - Intronic
1119432634 14:74578485-74578507 GTGTCAGGGGAGCCCGGGGCAGG - Intronic
1121837071 14:97101805-97101827 AGGTCACGGAACTACTGGGCGGG - Intergenic
1122221342 14:100240395-100240417 GGGTAACGGCAGCGCCGGGCGGG - Intronic
1122941899 14:104985186-104985208 GGGTGACGGGTGCGCTGGGACGG + Intergenic
1123018032 14:105384775-105384797 GGGGTACGGGAGGCCTGGGCGGG + Intronic
1123183494 14:106491613-106491635 GGGTCACGTGTCCACTGGACAGG + Intergenic
1123193220 14:106591480-106591502 GGGTCACGTGTCCACTGGACAGG + Intergenic
1125760298 15:42091886-42091908 GGGTCACGTGTCCACTGGACAGG - Intronic
1127525994 15:59792317-59792339 GGGTCAAGGCAGCAGGGGGCTGG + Intergenic
1127877549 15:63123674-63123696 GGGTCACGTGTCCACTGGACAGG + Intronic
1128063110 15:64747646-64747668 AGGTCACTGGAGCACTCTGCAGG - Intronic
1129360897 15:75023527-75023549 GCCTCACGAGAGCACCGGGCTGG - Intergenic
1129923291 15:79339208-79339230 GGGTCACGTGTCCACTGGACAGG - Intronic
1132677673 16:1127389-1127411 GGGTCTCAGGAGGACAGGGCCGG - Intergenic
1132767195 16:1540412-1540434 GGTTCACGCGTGCACGGGGCAGG - Intronic
1132849928 16:2020353-2020375 GGGTCTCGGGAGGTCTGAGCCGG + Intronic
1132857891 16:2055219-2055241 GGCTCAGGGGAGCCCAGGGCAGG - Intronic
1132943203 16:2518696-2518718 GAGTCAAGGGAGCTCTGGCCTGG + Intronic
1132967918 16:2669770-2669792 GGGTCACGTGTCCACTGGACAGG + Intergenic
1133752634 16:8736574-8736596 GGGTCACTGGATCACTGGATGGG + Intronic
1135670894 16:24374640-24374662 GGGTCACGTGTCCACTGGACGGG + Intergenic
1136073844 16:27804946-27804968 GGGGCACGGGAGCGCTGTGGAGG + Intronic
1136191201 16:28615788-28615810 GGGTCACGTGTCCACTGGACAGG + Intronic
1136267268 16:29129084-29129106 GGGTCACCTGAGGTCTGGGCAGG - Intergenic
1137038851 16:35591472-35591494 GGGTCACGAGTCCACTGGACAGG - Intergenic
1138180393 16:54937089-54937111 GGGTCACGGGATCACTGCGTGGG + Intergenic
1138575852 16:57906894-57906916 GGGGCAGGAGAGCACTGGGGCGG + Intronic
1140209747 16:72960638-72960660 GGGTCAGGGGAACACAGGGGAGG + Intronic
1140289726 16:73641938-73641960 AGGTGACGCGAGCTCTGGGCAGG + Intergenic
1141003984 16:80335121-80335143 GGGGCCAGGGAGGACTGGGCTGG - Intergenic
1141091485 16:81133320-81133342 GGGTCACGGGAGCCGGGAGCGGG + Intergenic
1141847383 16:86619989-86620011 GGGTCCCTGGAGCACTGGGGAGG + Intergenic
1141988331 16:87594397-87594419 AGGTGATGGGAGCACAGGGCAGG + Intergenic
1142070561 16:88089407-88089429 GGGTCACCTGAGGTCTGGGCAGG - Intronic
1142256390 16:89015719-89015741 GGGTGCAGGGAGCCCTGGGCAGG - Intergenic
1142415350 16:89938115-89938137 GGGTCACGTGTCCACTGGACAGG + Intergenic
1142535737 17:616640-616662 CTGTCCCGGGAGGACTGGGCTGG - Intronic
1142587456 17:982515-982537 GGGTCACGTGTCCACTGGACAGG - Intergenic
1143017441 17:3898451-3898473 GGGTCACCGGCTCACTGTGCTGG - Intronic
1143464501 17:7127005-7127027 GGGTCACGTGTCCACTGGACAGG - Intergenic
1144650819 17:17005715-17005737 GGGCCACTGGAGAGCTGGGCGGG + Intergenic
1145001604 17:19309069-19309091 GGGTCACTGCAGAAATGGGCGGG + Intronic
1145732040 17:27198163-27198185 GGGTCACGTGTCCACTGGACAGG - Intergenic
1145999297 17:29121795-29121817 GGCTCAGGAGTGCACTGGGCAGG - Intronic
1147821394 17:43243672-43243694 GAGTCACGTGTGCACTGGACAGG - Intergenic
1147822191 17:43248155-43248177 GAGTCACGTGTGCACTGGACAGG - Intergenic
1147823115 17:43253601-43253623 GAGTCACGTGTGCACTGGACAGG - Intergenic
1147823484 17:43255744-43255766 GAGTCACGTGTGCACTGGACAGG - Intergenic
1147830968 17:43297967-43297989 GAGTCACGTGTGCACTGGACAGG - Intergenic
1147836229 17:43333936-43333958 GAGTCACGTGACCACTGGACAGG + Intergenic
1151519636 17:74618867-74618889 TGGTCAAGGGAGCACAGAGCGGG - Intronic
1151558984 17:74860902-74860924 GGGAAACTGGGGCACTGGGCTGG + Intronic
1151577678 17:74960944-74960966 GGGACACGTGAGCACGGGGTGGG - Intronic
1152682519 17:81676491-81676513 GGGTCACGTGTCCACTGGACAGG - Intergenic
1152871263 17:82754321-82754343 GGGCCCCAGGAGCAGTGGGCGGG + Intronic
1152874301 17:82777533-82777555 GGGTCACGTGTCCACTGGACGGG + Intronic
1156568199 18:38220589-38220611 GGATCACAGGGGCATTGGGCTGG - Intergenic
1157123751 18:44936171-44936193 GGGTCCTGGGAGCCCTGGGCTGG - Intronic
1157566592 18:48682797-48682819 GGGTCCCGACAGCCCTGGGCGGG + Intronic
1159098790 18:63936585-63936607 GGCTCCTGGGAGGACTGGGCTGG - Intergenic
1160632646 18:80257564-80257586 GGGTCACGTGTCCACTGGACAGG + Intergenic
1160838407 19:1135583-1135605 GGGCCACGGGAGCCCAGGACTGG - Intronic
1161089789 19:2354028-2354050 GGGTCCCTGGAGCCCTGGGAGGG + Intronic
1161894043 19:7066900-7066922 GGGTCACGTGTCCACTGGACAGG + Intergenic
1161959632 19:7516399-7516421 GGGTCGCGGGAGCGATGGGGAGG + Intronic
1162290497 19:9776503-9776525 GGGTCACGTGTCCACTGGACAGG - Intronic
1162729989 19:12712647-12712669 GGGTCACGTGTCCACTGGACAGG - Intronic
1162908404 19:13836669-13836691 GGGTGAGGGGGGCACCGGGCGGG + Intergenic
1163449264 19:17366037-17366059 GGCTGCCGAGAGCACTGGGCAGG + Intronic
1163456255 19:17407486-17407508 GGGTCACGTGTCCACTGGACAGG + Intronic
1163881794 19:19930150-19930172 GGGTCACGTGTCCACTGGACAGG + Intronic
1164955162 19:32376853-32376875 GGGTCACGTGTCCACTGGACAGG + Intronic
1165058512 19:33194098-33194120 GGCTGCCTGGAGCACTGGGCTGG + Intronic
1165458171 19:35927056-35927078 TGGTCACAGGAGCCATGGGCAGG + Intergenic
1165541170 19:36492862-36492884 GGGTCACGTGTCCACTGGACAGG + Intergenic
1165671196 19:37680776-37680798 GGGTCACGTGTCCACTGGACAGG + Intronic
1165862866 19:38918341-38918363 GCGTCCAGGGAGCACTGGGGGGG - Intronic
1166483273 19:43191446-43191468 GGGTCACGTGTCCACTGGACAGG + Intronic
1166894895 19:46016927-46016949 GGGCCTGGGAAGCACTGGGCGGG + Intronic
1167519073 19:49941624-49941646 GGGTCACGTGTCCACTGGACAGG - Intronic
1167658202 19:50780167-50780189 GGGTTTCGGGAGCACGGGGCTGG - Intergenic
1167979142 19:53258329-53258351 GGGTCACGTGTCCACTGGACAGG - Exonic
1167990953 19:53360259-53360281 GGGTCACGTGTCCACTGGACAGG + Intergenic
1168131466 19:54322627-54322649 GGGTCACGTGTCCACTGGACAGG + Intergenic
1168215081 19:54919384-54919406 GGGTCACGTGTCCACTGGACAGG + Intergenic
1168405472 19:56108224-56108246 AGGTGGAGGGAGCACTGGGCAGG - Intronic
1168480888 19:56718770-56718792 GGGTCACGTGTCCACTGGACAGG + Intergenic
1202702719 1_KI270713v1_random:529-551 GGGGCATGGGAGCCCAGGGCAGG + Intergenic
925160196 2:1678102-1678124 GAGTGACGGGAGCACAGGGAGGG - Intronic
925607448 2:5673417-5673439 GGGCCGCGGGAGCCCTGGCCAGG + Intergenic
927200355 2:20574558-20574580 GGGCCAGGGGATCACTGGGAAGG + Intronic
928671454 2:33607374-33607396 GGGCCACAGGAGCAGTGGGCGGG + Intergenic
928676216 2:33654386-33654408 TGGCCACGGGAGCTGTGGGCTGG + Intergenic
928945396 2:36767386-36767408 GGAGCACTGGAGAACTGGGCCGG + Intronic
930115750 2:47716940-47716962 GGGTCACGTGTCCACTGGACAGG - Intronic
930813673 2:55569621-55569643 GGGTCACGTGTCCACTGGACAGG - Intronic
933720543 2:85394857-85394879 GGGGCAGGGGAGCATGGGGCAGG + Exonic
934735682 2:96688751-96688773 CGGGCACCGGAGGACTGGGCTGG + Intergenic
936388269 2:112049871-112049893 GGGTCACGTGTCCACTGGACGGG - Intergenic
936390046 2:112063682-112063704 TAGTCAAGGGAGCACTGAGCAGG - Intronic
936610894 2:114001094-114001116 GGGTTCCAGGAGCACAGGGCAGG + Intergenic
938145941 2:128835060-128835082 GGGTCCCAGTAGCAGTGGGCAGG - Intergenic
938727480 2:134120744-134120766 GGGACCCAGGCGCACTGGGCGGG + Intronic
940357147 2:152755615-152755637 GGGTCACGTGTCCACTGGACAGG - Intronic
940957015 2:159738991-159739013 GGGCCAAGGTAGCAGTGGGCTGG + Intronic
941662407 2:168208781-168208803 GAGTCATGGGAGCACTGCTCAGG - Intronic
941928243 2:170916698-170916720 GGGTCACGTGTCCACTGGACAGG - Intergenic
942563048 2:177240396-177240418 GGGCCATGCGAGCACTGGCCAGG + Intronic
945779565 2:214152774-214152796 GGGTCACGTGTCCACTGGACAGG + Intronic
946407184 2:219497989-219498011 AGTACACGGGCGCACTGGGCGGG - Intronic
947541358 2:230982024-230982046 AGGCCACGGGAGCACAGGTCAGG + Intergenic
947606567 2:231489792-231489814 GGGTCACGTGTCCACTGGACAGG + Intergenic
947634331 2:231672586-231672608 GGGTGACGCCAGCACTGGGTGGG + Intergenic
948048969 2:234964989-234965011 GGGTCACGGGAGCACTGGGCTGG - Intronic
948752019 2:240138425-240138447 GGGGCACTGGAAGACTGGGCAGG - Intergenic
948829235 2:240589707-240589729 GGGTCAGGAGAGCACAGAGCAGG - Intronic
949019316 2:241732314-241732336 GGGTCACGTGTCCACTGGACAGG + Intergenic
949046705 2:241875537-241875559 GGGTCACGTGTCCACTGGACAGG + Intergenic
1168797836 20:623254-623276 GGGCCTCTGGGGCACTGGGCAGG - Intergenic
1168898790 20:1342483-1342505 GGGTCACGGGAAGACTGGAATGG - Intronic
1169295494 20:4393873-4393895 GGGTCACGTGTCCACTGGACAGG + Intergenic
1171452910 20:25248434-25248456 CGGGCACGGGCGCACAGGGCGGG - Intronic
1172181459 20:33006359-33006381 GGGGCAAGGGAGCACTGGTTGGG + Intergenic
1172358941 20:34298930-34298952 GGGTCACGTGTCCACTGGACAGG - Intronic
1172627769 20:36358019-36358041 GATTCAGGGGAGCACTGGACAGG + Intronic
1172873697 20:38151430-38151452 AGGACACAGGAGCACTGGACCGG + Intronic
1173016999 20:39234772-39234794 GGGTCATGGGAGGCCTGGCCAGG + Intergenic
1173022898 20:39282951-39282973 GGGTCTCGCAAGCAGTGGGCAGG - Intergenic
1173658669 20:44718281-44718303 GGGTAGTGGGGGCACTGGGCGGG + Intronic
1175086544 20:56464286-56464308 GGGTCCCAGGAGCAGAGGGCTGG + Intergenic
1175795469 20:61767760-61767782 GGGACACTGCAGCCCTGGGCAGG + Intronic
1175825237 20:61933366-61933388 GGCACAGGGCAGCACTGGGCTGG - Intronic
1175948510 20:62569959-62569981 CGGACACGGGAGCAAGGGGCTGG - Intronic
1176007469 20:62874272-62874294 GGGTCACGTGTCCACTGGACAGG - Intergenic
1176027951 20:62995651-62995673 GGGTCACAGGGGCACAGGGCAGG + Intergenic
1176154988 20:63614828-63614850 GGGTCACGTGCCCACTGGCCAGG - Intronic
1176170783 20:63695514-63695536 AGGCCACGGGAGCTCCGGGCGGG + Exonic
1176180257 20:63746566-63746588 GGGTCCAGTGGGCACTGGGCGGG - Exonic
1176300524 21:5096906-5096928 AGCTCCGGGGAGCACTGGGCCGG - Intergenic
1176420290 21:6508632-6508654 GGGTCACGTGTCCACTGGACAGG + Intergenic
1179172442 21:38982996-38983018 AGCTCACGGGAGCACTGGGCAGG + Intergenic
1179856519 21:44165075-44165097 AGTTCCGGGGAGCACTGGGCCGG + Intergenic
1180006286 21:45022464-45022486 GGCTGAGGGGAGCTCTGGGCTGG + Intergenic
1180032925 21:45224519-45224541 GGGTTCGGGGAGCCCTGGGCGGG + Exonic
1180032963 21:45224616-45224638 GGGTTCAGGGAGCCCTGGGCGGG + Exonic
1180032978 21:45224658-45224680 GGGTTCCGGGAGCCCTGGGCCGG + Exonic
1180112032 21:45663213-45663235 GGGTCACGTGTTCACTGGACAGG - Intronic
1180201010 21:46224231-46224253 GGGTCACGTGTCCACTGGACAGG - Intronic
1180830766 22:18904899-18904921 GGGTCACGTGTCCACTGGACAGG + Intergenic
1180945127 22:19688505-19688527 GGGCCACGGGAGCACGTGTCCGG - Intergenic
1180992762 22:19947503-19947525 GGGTCACGTGTCCACTGGACGGG + Intronic
1181467566 22:23118404-23118426 TGGGCACTGGAGCCCTGGGCTGG + Intronic
1181575586 22:23792434-23792456 GGGTCACGGCAGCTCTGTGCAGG + Intronic
1181837866 22:25625866-25625888 GGGTCACGTGTCCACTGGACAGG - Intronic
1182049677 22:27303151-27303173 GGAGCAAGGGAGCACTAGGCTGG - Intergenic
1183525639 22:38320911-38320933 GGCACGCAGGAGCACTGGGCTGG + Intronic
1183704100 22:39466379-39466401 GGGTCATGGGAGCCCAGGCCTGG + Intronic
1183945462 22:41323439-41323461 GGGAAATGGGAGAACTGGGCTGG - Intronic
1184351608 22:43947741-43947763 GGGTCACGTGTCCACTGGACAGG + Intronic
1184660884 22:45965029-45965051 GGGTCTGGGGAGCCCAGGGCAGG - Intronic
1184668569 22:46001237-46001259 GTGCCATGTGAGCACTGGGCTGG - Intergenic
1184948479 22:47821614-47821636 GACTCATGGGAGCCCTGGGCTGG + Intergenic
1185081872 22:48713995-48714017 CAGACACGGGAGGACTGGGCTGG - Intronic
1185191032 22:49436224-49436246 GGCTCCTGGGAGCACTGGGCAGG - Intronic
1185285742 22:49999378-49999400 GGGTGAGGGGAGCACAGGGATGG - Intronic
1185408699 22:50671976-50671998 GGCTCAGGGCGGCACTGGGCAGG + Intergenic
1185408883 22:50672647-50672669 GGGTCCCGGGAGCAGGGAGCAGG - Intergenic
1185420879 22:50733729-50733751 GGGCCACGGCAGCACTGGCTGGG - Intergenic
1203241690 22_KI270733v1_random:25137-25159 GCGTTACGGCAACACTGGGCAGG - Intergenic
1203280855 22_KI270734v1_random:130170-130192 GGGTCACGTGTCCACTGGACAGG + Intergenic
949360663 3:3228997-3229019 GGGCCACAGGAGCAGTGGGTGGG - Intergenic
953059800 3:39417965-39417987 GGGTCACGTGTCCACTGGACAGG - Intergenic
953294186 3:41696413-41696435 GGGTCACGTGTCCACTGGACAGG - Intronic
953407532 3:42666861-42666883 CGGTCACGGGAGCTCTAGGTGGG + Intergenic
956374926 3:68603854-68603876 GTGTCAGAGGAGCACTGTGCTGG - Intergenic
956504226 3:69920619-69920641 GGGTCACGTGTCCACTGGACAGG - Intronic
960593370 3:119386785-119386807 GGGTCACGTGTCCACTGGACAGG + Intronic
964101435 3:152992641-152992663 GGGTCACGTGTCCACTGGACAGG - Intergenic
964269479 3:154939915-154939937 GGGTTACAGGGCCACTGGGCAGG - Intergenic
964662822 3:159139662-159139684 GGATCCCAGGAGCAGTGGGCTGG + Intronic
965644010 3:170860816-170860838 GGGTCACGTGTCCACTGGACAGG - Intergenic
966815584 3:183887255-183887277 GGGTCACGTGTCCACTGGACGGG - Intergenic
967228811 3:187318502-187318524 GGGTCAAGGCAGCAGTGGGGAGG - Intergenic
968050882 3:195654242-195654264 GGGTCACGTGTCCACTGGACAGG - Intergenic
968104942 3:195994096-195994118 GGGTCACGTGTCCACTGGACAGG + Intergenic
968303237 3:197631683-197631705 GGGTCACGTGTCCACTGGACAGG + Intergenic
968397817 4:259851-259873 GGGTCACGTGTCCACTGGACAGG - Intergenic
968404699 4:329821-329843 GGGTCACGTGTCCACTGGACAGG + Intergenic
969608518 4:8214241-8214263 GGGCCACGTGAGCTCTGGGAAGG + Intronic
970670592 4:18392185-18392207 GGGTCGCAGGAGCACAGAGCAGG - Intergenic
971399706 4:26264765-26264787 GGGTTATGGGAGCACAGTGCAGG - Intronic
972321214 4:37975188-37975210 GGGTCACGTGTCCACTGGACAGG + Intronic
972581131 4:40396630-40396652 GGGTCACAGGAGCACTGTAGAGG + Intergenic
973118393 4:46488776-46488798 GGGTCACTGGATAAATGGGCTGG - Intergenic
973245252 4:48004197-48004219 GGGTCACGTGTCCACTGGACAGG - Intronic
974493420 4:62595869-62595891 GGGTCACGTGTCCACTGGACAGG - Intergenic
975377786 4:73665702-73665724 GGGTCACGTGTCCACTGGACAGG + Intergenic
975378423 4:73671111-73671133 GGGTCACGTGTCCACTGGACAGG + Intergenic
975387438 4:73773813-73773835 GGGTCACGTGTCCACTGGACAGG + Intergenic
978484834 4:109240554-109240576 GGGCCAATGGAGCACAGGGCTGG - Intronic
979655475 4:123187906-123187928 GGATCACTTGAGCACTGGGGAGG + Intronic
979929900 4:126617344-126617366 GGGTCAGGGGAGCACTAGCTAGG + Intergenic
980671087 4:136008437-136008459 GGGTCAAGGCAGCAGGGGGCCGG - Intergenic
982712184 4:158768875-158768897 GGGTTACGTGAGCCCGGGGCGGG + Intergenic
982763372 4:159315668-159315690 GGGTCACGTGTCCACTGGACAGG + Intronic
984756211 4:183327955-183327977 GGGTCCCGGGAGCTGGGGGCAGG + Intergenic
984807537 4:183765493-183765515 GGGGCACGGGAGCAGTCGGGAGG + Intergenic
985613280 5:902826-902848 GGGTCACGTGTCCACTGGACAGG + Intronic
985746455 5:1651531-1651553 GGGTCAGGGGAGGGCGGGGCTGG + Intergenic
986720305 5:10556385-10556407 GGGTCACAGGAGAGCTGGGCTGG + Intergenic
987363957 5:17131687-17131709 GAGTTAGGGGAACACTGGGCAGG + Intronic
987971772 5:24955530-24955552 AGGTGACTGGATCACTGGGCCGG + Intergenic
988510318 5:31859055-31859077 GGGCCACAGGACCACTTGGCAGG - Intronic
988512601 5:31878327-31878349 GGTTGATGGGAGCACTGGGAAGG - Intronic
990023678 5:51159771-51159793 GGGCCAAGGCAGCACAGGGCTGG - Intergenic
998005015 5:138651084-138651106 GGGTCTCTGGAGCCCTGGCCTGG - Intronic
998152994 5:139768013-139768035 GGGACAGGGGAGCACTGCACAGG - Intergenic
999322588 5:150624692-150624714 GGGAGCCGGGAGCGCTGGGCGGG - Intronic
1005709768 6:28491786-28491808 GGGTCACGTGTCCACTGGACAGG - Intergenic
1006652095 6:35559959-35559981 GGGTCACGTGTCCACTGGACAGG + Intergenic
1006741266 6:36310737-36310759 GGGTGGTGGGAGCACTGGGGTGG + Intergenic
1007238779 6:40410323-40410345 GGGTGATGGGAGCACGGGGGAGG + Intronic
1007745016 6:44038368-44038390 GGGTCTGGGGAGAACTGGGCGGG + Intergenic
1007769442 6:44181005-44181027 GGGCCAAGAGAGCACTGGACAGG - Intronic
1011328291 6:86174891-86174913 GGGTCACGTGTCCACTGGACAGG + Intergenic
1013589517 6:111608407-111608429 GGGTCACGTGTCCACTGGACAGG - Intergenic
1015689505 6:135905927-135905949 GGGTCACCGCAGCACAGGGCAGG - Intronic
1017098193 6:150823970-150823992 GGCTCACGTGAGCACCGGGCAGG - Intronic
1018731708 6:166656550-166656572 GAGTCACGGGAGCACCTGCCGGG - Intronic
1019109375 6:169697733-169697755 GGGTCACGTGTCCACTGGACAGG - Intronic
1019197538 6:170291125-170291147 GGGGCAGGGGAGGACTGGGGGGG - Intergenic
1019486675 7:1292651-1292673 GGGTCCCGGGAGGGCTGGACTGG + Intergenic
1019556613 7:1634629-1634651 AGGTCATGGGAGCACAGGGATGG + Intergenic
1021969335 7:25951311-25951333 GGGTCACGTGCGCCCCGGGCGGG + Intergenic
1022630286 7:32078308-32078330 GAGACAGTGGAGCACTGGGCTGG - Intronic
1023074335 7:36468063-36468085 GGGTCACGTGTCCACTGGACAGG - Intergenic
1027135886 7:75623695-75623717 GGCTCTGGGGAGAACTGGGCTGG - Intronic
1029441079 7:100586889-100586911 GGGTCTCGGGACCCCCGGGCTGG + Intronic
1029562132 7:101309467-101309489 GGGTCACGTGTCCACTGGACAGG + Intergenic
1029756040 7:102574201-102574223 GGGTCACGTGTCCACTGGACAGG - Intronic
1029773982 7:102673273-102673295 GGGTCACGTGTCCACTGGACAGG - Intergenic
1030363852 7:108624387-108624409 GAGTCTGGGGAGCACTGGCCAGG + Intergenic
1033528898 7:142243905-142243927 GGGTAATGAGATCACTGGGCTGG - Intergenic
1033607291 7:142936696-142936718 GGCACTCGGGAGAACTGGGCTGG + Intergenic
1034514300 7:151562287-151562309 GGGCCACGGCAGCTCTGTGCCGG + Intronic
1035271173 7:157720825-157720847 GGGACAGCGGAGCCCTGGGCAGG + Intronic
1036692906 8:10956068-10956090 GGGAGCCAGGAGCACTGGGCAGG - Intronic
1037057268 8:14457747-14457769 GGGTCACGTGTCCACTGGACAGG - Intronic
1038339114 8:26669328-26669350 GGGCCACAGGAGCAGTTGGCAGG + Intergenic
1038584554 8:28777298-28777320 GGGCCACGGAACCACTGTGCTGG - Intronic
1039899722 8:41742671-41742693 GAGGCAAGGGAGCACTGGCCAGG + Intronic
1040757705 8:50800128-50800150 GGTTCACTGGAGAACTGGCCTGG - Intergenic
1048241009 8:132741553-132741575 GGGTCACGTGTCCACTGGACAGG + Intronic
1049458715 8:142710017-142710039 GGGTCACGTGTCCACTGGACAGG + Intergenic
1049687509 8:143944809-143944831 GGGGGAGGGGAGCAGTGGGCAGG + Intronic
1051357522 9:16253531-16253553 GGGTGAAGTGAGCTCTGGGCTGG - Intronic
1051920238 9:22256658-22256680 GGGTCAGGGGATGACTGGGCAGG + Intergenic
1052673375 9:31587209-31587231 GGGTCCCGGGAGATCTTGGCAGG - Intergenic
1054873214 9:70068352-70068374 GGGGGTAGGGAGCACTGGGCTGG + Intronic
1055703311 9:78970532-78970554 GGGCCACGGGAGCAGTGTGGAGG - Intergenic
1057179261 9:93021177-93021199 AGGGCACGGGGGCACTGGGAGGG - Intronic
1057554500 9:96076879-96076901 GGGTCACGTGTCCACTGGACAGG - Intergenic
1057806014 9:98220465-98220487 GGCTCTCGGGTGCACTGGGATGG + Intronic
1059216910 9:112573034-112573056 GGGTCCTGGGAGCACTGGTCAGG - Intronic
1060665868 9:125431849-125431871 GGGCCACAGGAGCCATGGGCAGG - Intergenic
1060786326 9:126454247-126454269 GGGTCAGGGCAGCAAGGGGCAGG - Intronic
1060982756 9:127803155-127803177 GGGTATCGGGAGCCCTGGACTGG + Intronic
1061039172 9:128129710-128129732 GGGTCACGTGTCCACTGGACAGG + Intergenic
1061048803 9:128182089-128182111 GGGTCACGTGTCCACTGGACAGG - Intronic
1061535412 9:131245335-131245357 GGGTCACGTGTCCACTGGACCGG - Intergenic
1061785562 9:133025895-133025917 GGGTCACGTGTCCACTGGACAGG - Intergenic
1061933890 9:133846861-133846883 GGGTCACCAGGCCACTGGGCAGG + Intronic
1061936455 9:133860421-133860443 GGTTCACAGAGGCACTGGGCAGG - Intronic
1062219872 9:135409438-135409460 GGGGCACGAGAGCCCTCGGCAGG - Intergenic
1062268821 9:135699633-135699655 GGGTCACGTGGGCCCCGGGCTGG - Intergenic
1062277732 9:135738711-135738733 GTGTTAGGGGAGCTCTGGGCAGG - Intronic
1062524709 9:136973537-136973559 GGGTCACTGTAGCACCAGGCTGG - Intergenic
1062531798 9:137004885-137004907 GGGTCACGTGTCCACTGGACGGG - Intergenic
1062535956 9:137021192-137021214 GGGTAACGGGAGCCCAGGACAGG + Intronic
1062648006 9:137559721-137559743 GGGTCACGTGTCCACTGGACAGG - Intronic
1188686366 X:33075195-33075217 GGGCCACAGGAGCAGTTGGCAGG - Intronic
1189472698 X:41326518-41326540 GGGTTACGGGAGCACAGAGCAGG + Intergenic
1190301530 X:49060009-49060031 GAGTCATGGGGTCACTGGGCAGG - Intronic
1191715952 X:64193650-64193672 AGCTCAGGGGACCACTGGGCAGG + Intronic
1192334406 X:70205311-70205333 GGGGCAGGGGAGGACTGGGGAGG + Exonic
1198082000 X:133248963-133248985 GGGCCACAGGAGCAGTTGGCAGG - Intergenic
1198287563 X:135207056-135207078 GGGTCACGTGTCCACTGGACAGG - Intergenic
1198344679 X:135747821-135747843 GGGTCACGTGTCCACTGGACAGG + Intergenic
1198382217 X:136094531-136094553 GGGTCACAGGACCACTTGGTGGG - Intergenic
1198998636 X:142606438-142606460 GGGTCACGTGTCCACTGGACAGG + Intergenic
1199416353 X:147587306-147587328 GGGTCATTGGAGCCCTGGTCTGG - Intergenic
1199759497 X:150894439-150894461 GAGTCATAGCAGCACTGGGCAGG + Intronic
1201649542 Y:16270271-16270293 GGGTCACGTGTCCACTGGACAGG - Intergenic
1202581912 Y:26390894-26390916 GGGTAACAGCAGCCCTGGGCTGG + Intergenic