ID: 948049102

View in Genome Browser
Species Human (GRCh38)
Location 2:234966080-234966102
Sequence GAGAAAGAGGAGAAAGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3383
Summary {0: 1, 1: 5, 2: 47, 3: 438, 4: 2892}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948049093_948049102 16 Left 948049093 2:234966041-234966063 CCCCTCCCGTTGTCTTTAAGGAA 0: 1
1: 0
2: 0
3: 7
4: 147
Right 948049102 2:234966080-234966102 GAGAAAGAGGAGAAAGAGGCTGG 0: 1
1: 5
2: 47
3: 438
4: 2892
948049097_948049102 10 Left 948049097 2:234966047-234966069 CCGTTGTCTTTAAGGAAACAAAG 0: 1
1: 1
2: 2
3: 37
4: 442
Right 948049102 2:234966080-234966102 GAGAAAGAGGAGAAAGAGGCTGG 0: 1
1: 5
2: 47
3: 438
4: 2892
948049094_948049102 15 Left 948049094 2:234966042-234966064 CCCTCCCGTTGTCTTTAAGGAAA 0: 1
1: 0
2: 0
3: 10
4: 149
Right 948049102 2:234966080-234966102 GAGAAAGAGGAGAAAGAGGCTGG 0: 1
1: 5
2: 47
3: 438
4: 2892
948049095_948049102 14 Left 948049095 2:234966043-234966065 CCTCCCGTTGTCTTTAAGGAAAC 0: 1
1: 0
2: 0
3: 3
4: 98
Right 948049102 2:234966080-234966102 GAGAAAGAGGAGAAAGAGGCTGG 0: 1
1: 5
2: 47
3: 438
4: 2892
948049096_948049102 11 Left 948049096 2:234966046-234966068 CCCGTTGTCTTTAAGGAAACAAA 0: 1
1: 0
2: 3
3: 26
4: 353
Right 948049102 2:234966080-234966102 GAGAAAGAGGAGAAAGAGGCTGG 0: 1
1: 5
2: 47
3: 438
4: 2892
948049091_948049102 21 Left 948049091 2:234966036-234966058 CCTGACCCCTCCCGTTGTCTTTA 0: 1
1: 0
2: 0
3: 5
4: 126
Right 948049102 2:234966080-234966102 GAGAAAGAGGAGAAAGAGGCTGG 0: 1
1: 5
2: 47
3: 438
4: 2892

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948049102 Original CRISPR GAGAAAGAGGAGAAAGAGGC TGG Intronic
Too many off-targets to display for this crispr