ID: 948049417

View in Genome Browser
Species Human (GRCh38)
Location 2:234968134-234968156
Sequence GTGGTAGCAATGATAATAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 1, 2: 1, 3: 21, 4: 150}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948049414_948049417 5 Left 948049414 2:234968106-234968128 CCAGGTAGTTAGGGATCTGGTCA 0: 1
1: 0
2: 0
3: 4
4: 92
Right 948049417 2:234968134-234968156 GTGGTAGCAATGATAATAGATGG 0: 1
1: 1
2: 1
3: 21
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948049417 Original CRISPR GTGGTAGCAATGATAATAGA TGG Intronic
904147804 1:28408585-28408607 GTGGAAGTAATCATAATAGCAGG + Intronic
908353312 1:63307719-63307741 GTGAGAGCAATGTTAATATAGGG + Intergenic
908406257 1:63816886-63816908 GTGGTGATAATGACAATAGAAGG + Intronic
910162817 1:84292224-84292246 GTGGTAGCAACGAAAAGTGATGG - Intergenic
910523024 1:88145065-88145087 GTGGTAGCAATGGGATCAGAAGG - Intergenic
912560989 1:110551465-110551487 GTGGAAGCAAGGAGAAAAGATGG + Intergenic
912947102 1:114094456-114094478 GTGGTAACAATGATGACACATGG + Intronic
914220591 1:145678507-145678529 GTGGTAGAAATGATTAGAAAGGG - Exonic
914473170 1:148001377-148001399 GTGGTAGAAATGATTAGAAAGGG - Intergenic
914886786 1:151591834-151591856 CTGATGGCAATGATAATAGCTGG - Intergenic
917894698 1:179476232-179476254 GTGATAGAAATGATGACAGATGG - Intronic
919042450 1:192408675-192408697 GTGGTTGCACTGATATTACAGGG - Intergenic
919540937 1:198844301-198844323 GTGAAAGAAATGATAATAAAAGG - Intergenic
920009267 1:202855951-202855973 GTGGCAGCAGAGATCATAGATGG + Intergenic
920595812 1:207268832-207268854 GTGATAGCAATCAGAACAGAGGG + Intergenic
922812172 1:228423178-228423200 GTAGAAGCAATGATAGTAAAAGG - Intergenic
1066217281 10:33300108-33300130 GTGATAGCAAAGAAAAGAGAAGG - Intronic
1068307071 10:55225351-55225373 TTTGATGCAATGATAATAGAGGG - Intronic
1070249441 10:74761195-74761217 TTGGAAGCAATGATCAGAGATGG - Intergenic
1070350806 10:75590629-75590651 TTGGTAGCTATTATAATATATGG + Intronic
1071312230 10:84353634-84353656 GTGGTAGCCATGCTAATTGCAGG - Intronic
1072347131 10:94519221-94519243 ATGGTAGCAAAGTAAATAGAAGG - Intronic
1074919081 10:117988935-117988957 GGAGTAGAAATGATGATAGAAGG - Intergenic
1083231771 11:61326079-61326101 GTGGTAGCCCTGATAATGGGGGG - Intronic
1084293324 11:68191396-68191418 GAGGTTGCAATGAGAAGAGATGG - Intronic
1087581191 11:100056645-100056667 CTGGTAGTAATGATAGTAGTGGG + Intronic
1091153533 11:133351978-133352000 GGGGCAGCAATGAAAATAGCAGG - Intronic
1091515173 12:1172570-1172592 GTGCCGTCAATGATAATAGAAGG - Intronic
1092751143 12:11720104-11720126 TTGGTATCAGTGATTATAGAAGG + Intronic
1098450684 12:70615238-70615260 TTGGAAGCAATGATAATTTACGG - Intronic
1098708106 12:73717298-73717320 GTGATAGGAATAATAATTGATGG + Intergenic
1099081439 12:78187710-78187732 GTGTTATCTATGATAATATAAGG - Intronic
1099898916 12:88682880-88682902 GTGGTAGCAAAGAGAAAAGTAGG - Intergenic
1100885354 12:99064040-99064062 GTGGTGGGAAAAATAATAGAGGG - Intronic
1102406902 12:112681185-112681207 GTGGCAGCAAGGATCATACAGGG - Intronic
1103179034 12:118891685-118891707 GAGGTAGAAATGAGCATAGAAGG + Intergenic
1105737861 13:23289987-23290009 GTGGTAGCAATGGTCAGAGAGGG + Intronic
1106246164 13:27952689-27952711 GTGTTAACATTGTTAATAGAGGG + Intergenic
1106275085 13:28197039-28197061 GTGGTGGTAAGGATATTAGAAGG + Intronic
1106364745 13:29067585-29067607 GTAGAAGCAATGAGAATAGACGG + Intronic
1108807710 13:54180270-54180292 GTGGCAGGAATGAAAAGAGAGGG - Intergenic
1111427601 13:88108637-88108659 GTGAAGGCAATGATAAGAGAGGG - Intergenic
1117350682 14:54878523-54878545 GAGGTAGCTCTGATATTAGATGG - Intronic
1117484697 14:56182666-56182688 GTTGTAGCAATGACATTAAATGG - Intronic
1117915957 14:60678079-60678101 GTTGTAGTAATCAAAATAGAGGG + Intergenic
1121423070 14:93829390-93829412 GTGGCAGTAATGTTAATAGCCGG - Intergenic
1122832353 14:104405440-104405462 GTGGAAGCAATGAGACTAGAGGG + Intergenic
1126834873 15:52651563-52651585 GTGATAGAAATGAGAATACAGGG - Intronic
1127157420 15:56142600-56142622 GTAGTAGCATTTATAATAAAGGG - Intronic
1129498289 15:76008704-76008726 GTGGTAGCAAATAAAAAAGAAGG - Intronic
1129576494 15:76753605-76753627 GTTGTAAAAATAATAATAGATGG + Intronic
1131958632 15:97764935-97764957 GTGGTAGCAGTAGTAATAGAAGG + Intergenic
1145159968 17:20567676-20567698 GTGGAGGCAATGAAAAGAGAAGG + Intergenic
1146106131 17:30039091-30039113 GTGGTAGCTGTGCTAAAAGACGG - Intronic
1146519097 17:33512462-33512484 GTGGGAGCAATAATAATAAGTGG - Intronic
1153327289 18:3833665-3833687 GTGTGATCAATGAAAATAGAGGG + Intronic
1155365518 18:25045533-25045555 GTGGTAGCAATAATGAGATAGGG - Intergenic
1156375987 18:36515725-36515747 GTGGTGGCAATGGAAATATAGGG - Intronic
1156379627 18:36546208-36546230 GTAGTAGCACTGAAAACAGAGGG - Intronic
1158398191 18:57096143-57096165 TTGGGAGCAGTGATAAGAGAAGG + Intergenic
1160219859 18:76966827-76966849 GAGGAAGGAATGATAATAGATGG + Intronic
1164813932 19:31179709-31179731 GTGGTAACAATGATGATGGTAGG + Intergenic
1167890663 19:52536698-52536720 CTGGTGGCAATGAGAACAGAGGG + Intronic
930485392 2:52006284-52006306 TTGGTAACAATGAGAATAAAAGG + Intergenic
930713050 2:54567236-54567258 GTGGTAGGAAGGATTCTAGAAGG + Intronic
931710626 2:64987174-64987196 GTGGTAGCAGTGGGAATAGATGG + Intergenic
935728068 2:106041080-106041102 GTGGTAGCAATAATAATAGATGG - Intergenic
938657859 2:133452966-133452988 TAGGTAGCAATGGTAATAGCAGG - Intronic
939012325 2:136861273-136861295 GTGGGAGAAATCATTATAGAAGG - Intronic
939265832 2:139871718-139871740 ATTGTAGAAATGATAGTAGAAGG + Intergenic
939333045 2:140789314-140789336 GTGGTAGCAGGGGTAATGGAAGG - Intronic
941563612 2:167080130-167080152 GTTGTAGCATTGAAAATAAATGG + Intronic
942839498 2:180342084-180342106 GTGGTAGAAAGGAAAATAGAAGG - Intergenic
943026018 2:182629389-182629411 GTGGTAGTAATGTGGATAGAGGG - Intergenic
943493983 2:188595679-188595701 GTGTTACCATTGATAATAAATGG - Exonic
945205197 2:207324128-207324150 GAGCCAGCAATGATAGTAGATGG + Intergenic
945274230 2:207972246-207972268 GAGGTAGGCATGATAATAGTAGG + Intronic
947202924 2:227631327-227631349 GTGGCAGAAAGGAGAATAGAAGG + Intronic
947655346 2:231821897-231821919 GTGGTTGCCAGGATAATGGAGGG - Intergenic
948049417 2:234968134-234968156 GTGGTAGCAATGATAATAGATGG + Intronic
1168995642 20:2130880-2130902 GTGGTTTGAATGACAATAGAGGG + Intronic
1177264934 21:18770289-18770311 GTTGTAACAATGATTCTAGAGGG + Intergenic
1179330654 21:40397819-40397841 GTGGTAGTAGTGATGATAGTAGG - Intronic
1182221215 22:28760430-28760452 GTGGGAGGTATGCTAATAGACGG + Intergenic
1182866486 22:33608666-33608688 GTGGTTACAGTGATAATACAAGG - Intronic
1183120930 22:35729457-35729479 CCAGCAGCAATGATAATAGAAGG + Exonic
949598292 3:5571515-5571537 ATAGTATCAATAATAATAGAAGG - Intergenic
951186912 3:19723902-19723924 GTGGTAGAAAAGATCAGAGAGGG - Intergenic
951565098 3:24005216-24005238 GTGGTGGCAAAGAAAATAGAAGG - Intergenic
952020291 3:29010423-29010445 GTAGTATCAATGATATGAGAGGG + Intergenic
952924315 3:38310058-38310080 GTAGTAAGAATGATAAAAGATGG + Intronic
958955528 3:100461874-100461896 GTTGTAGCAATGAGAATAGAGGG - Intergenic
960695287 3:120389652-120389674 GAGGTAGCATTGATAACAGCTGG + Intergenic
961359745 3:126359573-126359595 GTAGTAACAATGAAAACAGAAGG - Intergenic
962292695 3:134149921-134149943 GTGTTAGCAATGATAGTAGCAGG - Intronic
962795910 3:138849460-138849482 GTGACAGCAATAATAATAGGGGG + Intergenic
963265529 3:143236521-143236543 GTGGTAGAATTGATAAAACATGG + Intergenic
965632476 3:170747305-170747327 ATGATAGCAAAGATAATTGATGG - Intronic
966454188 3:180095875-180095897 TTGGTAGCACTGTTAATAAAGGG + Intergenic
967826048 3:193878394-193878416 TTGTTAGCAATGAAAATAAAAGG - Intergenic
970575136 4:17419754-17419776 GTGGTGGCAAGAATATTAGATGG + Intergenic
970967353 4:21943845-21943867 GTGGTAGAAATGGAAATTGAAGG + Intronic
971098023 4:23430185-23430207 CTGGTAGACTTGATAATAGAAGG - Intergenic
971732833 4:30407332-30407354 GTGGTAGCTATGGGAATAGTAGG - Intergenic
978227655 4:106357028-106357050 ATGGTAGCAGTGAAAATTGAAGG - Intergenic
979030759 4:115642552-115642574 TTGAAAGCAATGATGATAGAGGG - Intergenic
979763518 4:124436471-124436493 GTGGCAGCAATTGTCATAGATGG + Intergenic
980142083 4:128930685-128930707 GTGGTATCAATGAAGAAAGACGG + Intronic
983260276 4:165448647-165448669 ATGCTCGCAATGATAAAAGAAGG - Intronic
983923068 4:173368495-173368517 GTGGTAAAAATGAGAATATATGG - Intergenic
988727591 5:33939402-33939424 GGGGTAGGAAAGAAAATAGAAGG + Intergenic
988997257 5:36726104-36726126 GTGGTTGAAATGATAATGGAGGG + Intergenic
989141769 5:38208590-38208612 GTGGTAGCAATGATTATTAATGG - Intergenic
990491176 5:56304314-56304336 CTGGTAGCAATGTTTAAAGAGGG + Intergenic
991211551 5:64110732-64110754 GAGGTAGCAGTGCTAATAGTTGG - Intergenic
993745292 5:91589691-91589713 GTGATAGCACTGATAACTGATGG + Intergenic
994322716 5:98411566-98411588 GTGATACCAATCATAATTGAAGG - Intergenic
994785724 5:104159756-104159778 GTTGTTGCAATGATAATTCAAGG - Intergenic
994968796 5:106708990-106709012 TTGGTAGCAATGACAATTAAAGG + Intergenic
995686860 5:114781175-114781197 GTGGTCCCAATGAGAACAGAGGG - Intergenic
997934699 5:138100162-138100184 GTGGAAGCAAAGGTAATAGAGGG - Intergenic
998660460 5:144231123-144231145 GAATTAGCAATGAAAATAGAAGG - Intronic
998670883 5:144352273-144352295 CTGGTACCAAGGATAAGAGAAGG + Intronic
999819879 5:155216055-155216077 GTGGTAGCAATGAGATTTGGAGG + Intergenic
1000273535 5:159710735-159710757 GAGGTAAGAATGCTAATAGAAGG - Intergenic
1002894895 6:1372200-1372222 GTGGTGGCAATGACTATAGAGGG + Intergenic
1003958272 6:11186388-11186410 TTGGTAGCAATGAGGAAAGAAGG - Intronic
1004052517 6:12100145-12100167 GTGGTAGAAATGTTAATCAAGGG + Intronic
1005232656 6:23722154-23722176 GTGATAATAGTGATAATAGATGG - Intergenic
1006981100 6:38148989-38149011 CTGGTAGCAATGAGAATATATGG - Intronic
1007569273 6:42877645-42877667 GTGGTACCAATAATATTAAAAGG - Intergenic
1007672048 6:43563749-43563771 ATGGTATAAATGATAAAAGATGG + Intronic
1008838171 6:55863579-55863601 GTTGTAGCAGTGATAATTAAAGG - Intronic
1009909665 6:69910294-69910316 GTGGTACCATTGATACAAGAAGG - Intronic
1011984704 6:93428779-93428801 GTGGCAGCAATGATAGCTGAGGG - Intergenic
1012604840 6:101145023-101145045 GTTGAAGCTATGATAATGGATGG + Intergenic
1012785175 6:103615650-103615672 GTGTAAGTAATAATAATAGATGG + Intergenic
1014515702 6:122375811-122375833 GAGGGAGCAGAGATAATAGAGGG + Intergenic
1016976662 6:149815511-149815533 ATTGTAGCAATGATATTAGAAGG - Intergenic
1019234002 6:170594052-170594074 ATGGTAGAAATGATAAGACATGG - Intergenic
1021138967 7:16999691-16999713 GTGATAGCATTGAAAATAAAAGG + Intergenic
1022068000 7:26881061-26881083 GTAGTAGAAATAATAAAAGATGG - Intronic
1024936309 7:54715477-54715499 GTGGTAACAATTATGATAGATGG + Intergenic
1025189190 7:56883769-56883791 GTGCTAGCAATCAAAATAGCAGG + Intergenic
1025682749 7:63693148-63693170 GTGCTAGCAATCAAAATAGCAGG - Intergenic
1027184103 7:75959978-75960000 GTAGCAGTAATGATAATAAATGG + Intronic
1028446809 7:90933892-90933914 GTGGTAGCAACAGTAACAGATGG + Intronic
1030170779 7:106600634-106600656 GTGGTGGCAATGGTAATAAAAGG + Intergenic
1033722319 7:144074690-144074712 GTGGTAGCAGTAACACTAGATGG - Exonic
1033722611 7:144077774-144077796 GTGGTAGCAGTAACACTAGATGG - Intergenic
1034829565 7:154297746-154297768 GTGGGAGAAAACATAATAGAAGG - Intronic
1035323384 7:158049158-158049180 ATGGTGGCAATGATGATTGATGG - Intronic
1037025810 8:14035803-14035825 CTGTTAGCAATGATAGGAGAAGG + Intergenic
1043799524 8:84590001-84590023 GTGTTATCAATGATAATATATGG - Intronic
1045004382 8:97904930-97904952 TTGCTTGCAATCATAATAGAAGG - Intronic
1046569834 8:115949416-115949438 ATGGTAGAAATGAAGATAGATGG + Intergenic
1046983613 8:120363361-120363383 GTGGGAGCAATGAGAACACAGGG + Intronic
1047085090 8:121507114-121507136 GTGGTAGCACTGAAAATTGGTGG + Intergenic
1047190182 8:122671945-122671967 ATGGTAGAAATGGTAAAAGAGGG + Intergenic
1049860349 8:144894101-144894123 GGGGTAGAAATGATGGTAGAGGG - Intronic
1056267995 9:84918789-84918811 GTGGTAGTGATGAAAATAAAAGG - Intronic
1057286721 9:93762075-93762097 CTGTTATCAATGATAATAGAAGG - Intergenic
1058846530 9:108965906-108965928 GTAGTAGCAGTGGTAATAGTAGG + Intronic
1060431508 9:123554763-123554785 GTGGTGCCAATTATAATCGAAGG - Intronic
1186016180 X:5196882-5196904 ACGGTAGCAAAGATTATAGATGG - Intergenic
1186596712 X:10989589-10989611 GTGGCAGTAATGATAACTGAGGG + Intergenic
1189723468 X:43944716-43944738 AGGGTAGCAATGATGATAGAGGG + Intergenic
1189807581 X:44751109-44751131 GTGTTAGCAATGAGTATTGAGGG - Intergenic
1196184025 X:112726129-112726151 GTTGTAGCAATGGCAACAGATGG + Intergenic
1197346933 X:125335606-125335628 ATGGTAGCCTAGATAATAGAGGG - Intergenic
1198284013 X:135171860-135171882 ATGGTAGCAATGATCATAAAAGG - Intergenic
1198286375 X:135195366-135195388 ATGGTAGCAATTATTATAAAAGG - Intergenic
1198373911 X:136018452-136018474 GTGGGTGCAATGAAAACAGAAGG + Intronic
1199324575 X:146482192-146482214 GTGGTAGGAAGGATAATTGGTGG + Intergenic