ID: 948051134

View in Genome Browser
Species Human (GRCh38)
Location 2:234980170-234980192
Sequence CCTTATCTGCAGGGGATACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 105}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948051121_948051134 -4 Left 948051121 2:234980151-234980173 CCCCTGTAAGTAGTCCCCCCCTT 0: 1
1: 0
2: 0
3: 9
4: 84
Right 948051134 2:234980170-234980192 CCTTATCTGCAGGGGATACAGGG 0: 1
1: 0
2: 0
3: 10
4: 105
948051120_948051134 1 Left 948051120 2:234980146-234980168 CCTTTCCCCTGTAAGTAGTCCCC 0: 1
1: 0
2: 1
3: 23
4: 186
Right 948051134 2:234980170-234980192 CCTTATCTGCAGGGGATACAGGG 0: 1
1: 0
2: 0
3: 10
4: 105
948051122_948051134 -5 Left 948051122 2:234980152-234980174 CCCTGTAAGTAGTCCCCCCCTTA 0: 1
1: 0
2: 0
3: 3
4: 38
Right 948051134 2:234980170-234980192 CCTTATCTGCAGGGGATACAGGG 0: 1
1: 0
2: 0
3: 10
4: 105
948051123_948051134 -6 Left 948051123 2:234980153-234980175 CCTGTAAGTAGTCCCCCCCTTAT 0: 1
1: 0
2: 0
3: 2
4: 36
Right 948051134 2:234980170-234980192 CCTTATCTGCAGGGGATACAGGG 0: 1
1: 0
2: 0
3: 10
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948051134 Original CRISPR CCTTATCTGCAGGGGATACA GGG Intronic
906639181 1:47431441-47431463 CCTTGTCTGCACAGGATACCTGG - Intergenic
908161104 1:61409490-61409512 CCTTATTTGGAGGGGATTTAAGG + Intronic
910932767 1:92459010-92459032 CTTTATCTGTTGGGAATACATGG - Intergenic
911179354 1:94847455-94847477 GCTTATCTGCAAGGGACACCAGG + Intronic
916518612 1:165543680-165543702 CCTAATCTGCAGGCCATAGAGGG - Intergenic
923703942 1:236327854-236327876 CCTTTGCTGCAGAGGATCCAGGG + Intergenic
1064311957 10:14219686-14219708 CCTTCTCTGAAGGTGTTACATGG - Intronic
1068405929 10:56588795-56588817 CCTTATCTGAATGGTATACTTGG + Intergenic
1070828869 10:79406670-79406692 CCTCATCTGTAGGGGTTACAGGG - Intronic
1072547269 10:96449344-96449366 GCTTATTCCCAGGGGATACAAGG + Intronic
1073917799 10:108426853-108426875 CCTTGTCTGCACAGGACACAGGG - Intergenic
1076918667 10:133440197-133440219 CTTTGTCTGCAGTGGAGACAGGG - Intergenic
1081639189 11:44741100-44741122 GCTTTTCTCCAGGGGACACAAGG - Intronic
1082708209 11:56519620-56519642 CCTTAAATGAAGGGGAGACAAGG - Intergenic
1085466027 11:76723912-76723934 CCTTGGCTGCAGGGGCTGCAGGG - Intergenic
1087377969 11:97367967-97367989 CTTCATCTGCAGGGGGTAGATGG - Intergenic
1087860849 11:103152914-103152936 CCTTAGCTGCATGGGAGACTGGG + Intronic
1089398663 11:118152250-118152272 CCTTGAGTGCAGGGGATACCAGG - Intronic
1091932809 12:4410347-4410369 TCTTATCTGCAGGAGATATTGGG + Intergenic
1101046621 12:100813207-100813229 CCTTATTTCCAGGGGAAGCATGG + Intronic
1110643942 13:77859309-77859331 CCTTAACTAAAGGGGATCCAGGG - Intergenic
1110984888 13:81954675-81954697 CCTTATCTGAAGGGGATATTAGG + Intergenic
1117153060 14:52909017-52909039 CCTTAGCTGCAAGGGAGACTGGG - Intronic
1117290003 14:54323018-54323040 CCTTCCCTGCAGGGGAGTCATGG - Intergenic
1118062276 14:62152541-62152563 CCATGTCTGCAGGGGAAAGAAGG - Intergenic
1118893852 14:69930047-69930069 CCATCTCTGAAGTGGATACAGGG - Intronic
1120624246 14:86804605-86804627 CTTTATCTGGAAGGGATACAAGG + Intergenic
1121533879 14:94677832-94677854 CCTTAGCTGTAGGGGAAGCAGGG - Intergenic
1122628371 14:103096004-103096026 CCTTATTTGCAGGGGCTGGAAGG + Intergenic
1124641740 15:31400203-31400225 CATTTTCTGCAGGGAATCCACGG + Intronic
1128855262 15:71005832-71005854 CCATATCTGCTAAGGATACAAGG + Intronic
1131287474 15:91073376-91073398 CCTGATCTGCAGGGCATAACTGG - Intergenic
1135245872 16:20856587-20856609 CCTTATCAGAAGGGCAGACATGG + Exonic
1141578697 16:84982519-84982541 CCCTGTCAGCAGGGGCTACAGGG - Intronic
1141862676 16:86728601-86728623 CCTTAGCTGAAGGGGACAGAGGG + Intergenic
1143101161 17:4505600-4505622 CCCTATCTGCAGAAGAGACAGGG - Intronic
1144288224 17:13800306-13800328 CCTTCTCTGCAAGGGAGAGAGGG - Intergenic
1144485723 17:15662724-15662746 CATTATCTACATGAGATACAGGG + Intronic
1146569355 17:33939511-33939533 CTTTTTATGCAGGGGATCCAGGG - Intronic
1147464034 17:40596869-40596891 TCCTAACTGCAGGGGATACCGGG + Intergenic
1149651008 17:58276449-58276471 CCTTCTCTGCAGGGGCCAGAGGG + Intronic
1152323847 17:79624334-79624356 CCTTAGCTGCAGGGGAGGCTGGG + Intergenic
1152684252 17:81686371-81686393 GCTTACCTCCAGGGCATACAAGG - Exonic
1153264610 18:3257858-3257880 ACTTATCTGAAAGGGAAACAGGG - Intergenic
1153439184 18:5098478-5098500 CCTTATCTTCAGGTGATGCCTGG - Intergenic
1156957919 18:42991428-42991450 CATCACCTGCAGTGGATACACGG - Intronic
1158107731 18:53904701-53904723 CCTTTTCTGCTGGGGTTACCAGG + Intergenic
1160008021 18:75082591-75082613 TCTTATCTGGAGGGGAGCCAGGG + Intergenic
1165350173 19:35270804-35270826 CCGTATGTGCAGGGGACACCTGG + Exonic
1165746057 19:38229871-38229893 CATTGGCTGCTGGGGATACAGGG + Intergenic
1165949259 19:39464790-39464812 CTTGATCTGCAGGGGCTGCAGGG - Exonic
925220057 2:2131844-2131866 CGTTCTCTGCAGGAGGTACATGG + Intronic
926754888 2:16226757-16226779 CCTTAACTTCAGTGGAGACAGGG - Intergenic
926787192 2:16530141-16530163 CCCCATCTGCACTGGATACATGG - Intergenic
926793987 2:16603732-16603754 CCTTAAGTGCTGGGAATACAAGG - Intronic
928326018 2:30320143-30320165 CCTTACCTGCAGGGGAGAGTGGG - Intronic
929718396 2:44337870-44337892 TCTTATCCGCAGGGGATGCAGGG - Intronic
930929039 2:56858724-56858746 CCTAATGTGCAGGGATTACAGGG + Intergenic
932254844 2:70275690-70275712 CATTTTCTGCAGGGGATATCAGG - Intronic
934950938 2:98575003-98575025 CCTTATCCCCAGGGGATGCCTGG - Intronic
937449447 2:121989777-121989799 CTTGATCTCCAGGGGATCCAGGG + Intergenic
940361113 2:152797159-152797181 TCTTCTCTGCAGGGGATGCAGGG + Intergenic
943413485 2:187568673-187568695 CTTTATCTGCCAGGGATAAAGGG + Intergenic
943523911 2:188992919-188992941 CCTTAGCACCAGGGGATCCAGGG - Exonic
948051134 2:234980170-234980192 CCTTATCTGCAGGGGATACAGGG + Intronic
1172590795 20:36116496-36116518 CCCTATCTGGAGGGTAGACAAGG + Intronic
1173618325 20:44417384-44417406 CATTCTCTGCAGGGGGTACAAGG - Intronic
1174380400 20:50152477-50152499 CCTTAACTCCTGGGGATATAGGG + Intronic
1178918521 21:36723109-36723131 CCTGACCTGCAGCGGATACAAGG + Exonic
1183710199 22:39498841-39498863 CCTTAGCTGCAGGGGGAGCAGGG - Intergenic
1185171578 22:49297581-49297603 CCTTCTCTGCAGGGGGTGCCTGG - Intergenic
953910426 3:46890007-46890029 CCTTATCTCCTGGGGATGAAGGG - Intronic
959869587 3:111311050-111311072 CCATATCTGAAGGGGGCACAGGG + Intronic
963220270 3:142801845-142801867 CCTAATTTGCAAGGGATAAAAGG - Intronic
965465608 3:169027035-169027057 CATTGTCTGCAGGTGATTCATGG - Intergenic
969191691 4:5526514-5526536 ACTTAGCAGCAGGGCATACAGGG - Intronic
970533635 4:17007061-17007083 CCTTATCTGCAAGGGAATCTGGG - Intergenic
971921022 4:32939321-32939343 CCTCATCTGGAGGGTATATATGG - Intergenic
972047927 4:34692705-34692727 AGTTATCTGCAGGTGATACCAGG + Intergenic
972627016 4:40809243-40809265 CCTTCCCTGCAGGGGAAACTTGG - Exonic
974800770 4:66815018-66815040 TGTTAGGTGCAGGGGATACAGGG - Intergenic
975441065 4:74411171-74411193 CCTTGTCTGCAGGGTAGACCAGG + Intergenic
975577284 4:75875851-75875873 CCCTAGCTGCAGGGGAGACTTGG - Intronic
977977083 4:103278276-103278298 CCTTATCTCCTGCGGCTACAGGG - Intergenic
979253341 4:118587841-118587863 TCTTATTTCCAGGGGATTCAGGG - Intergenic
979801544 4:124915595-124915617 GATTATGTGCAGAGGATACATGG + Intergenic
987799077 5:22669638-22669660 ATATATCTGCAGGTGATACAAGG - Intronic
988207860 5:28163471-28163493 CTTTATATTCAGGGGATACATGG - Intergenic
990187212 5:53221727-53221749 CTGTTTCTGCAGGGGATACTGGG + Intergenic
990385869 5:55261494-55261516 CCTTATCTACATGGGAAAAAGGG + Exonic
995228440 5:109730597-109730619 TCTTAACTCCAGGGGATACATGG - Intronic
996188670 5:120512173-120512195 CTGTATCTGGAGGGGAAACAAGG - Intronic
996615483 5:125436216-125436238 CATTATCTGCTGGGTGTACAGGG - Intergenic
1002176238 5:177403042-177403064 CCAAATCTCCTGGGGATACAGGG - Intronic
1011826025 6:91306616-91306638 CCCTTTCTGCAGGGGATAAGAGG + Intergenic
1017227809 6:152041120-152041142 AGTTATCTGCAGGAGATGCAGGG + Intronic
1017233411 6:152096047-152096069 CCTCATCTGCAGGGAAGAGATGG + Intronic
1017410381 6:154161738-154161760 CGTTAGGTGCAGGGAATACAGGG - Intronic
1019191803 6:170255714-170255736 CCTTCTCTGCAGTGGTCACAGGG + Intergenic
1023417472 7:39946874-39946896 TCTTATCTGCAAGGAATACTGGG + Intergenic
1024214934 7:47240590-47240612 CCATTTCAGCAGGGGAAACATGG - Intergenic
1026894702 7:74003268-74003290 TCTTATCTCCAGGGGAGAGAGGG + Intergenic
1027491113 7:78827534-78827556 CCTAATGTGCTGGGAATACATGG + Intronic
1029115769 7:98236369-98236391 CCTTCTGTCCAGGGGAAACAAGG - Intronic
1032153592 7:129450760-129450782 CCTTCTCTGCAGCCTATACAGGG + Intronic
1032153870 7:129452699-129452721 CCTTCTCTGCAGCCCATACAGGG + Intronic
1035178918 7:157075253-157075275 TCTTGTCTGAAGGGGGTACAGGG - Intergenic
1040854906 8:51938608-51938630 TCTAATCTGCAGAGGATACAAGG + Intergenic
1042768629 8:72354674-72354696 CCTTACCTGTAGGAGATACTTGG + Intergenic
1048006597 8:130424591-130424613 CCTTCTCAGCAGGTGATAAAAGG + Intronic
1050826391 9:9951586-9951608 CCTTGCCTGGAGGGCATACATGG + Intronic
1056790478 9:89622229-89622251 CCTTGCCTGGAGTGGATACATGG + Intergenic
1059624979 9:116053817-116053839 ACTAATATGCAGGCGATACAAGG - Intergenic
1198302579 X:135345789-135345811 TCTTCTCTGGAGGGGATTCAAGG - Intronic
1202337088 Y:23823979-23824001 CATTTTCTGCAGGGCCTACAGGG + Intergenic
1202533677 Y:25846092-25846114 CATTTTCTGCAGGGCCTACAGGG - Intergenic