ID: 948052688

View in Genome Browser
Species Human (GRCh38)
Location 2:234990578-234990600
Sequence GCGTGGACCAGCTCTTGGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 81}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948052684_948052688 -1 Left 948052684 2:234990556-234990578 CCCTGAAAGACTCAGCTCTGCAG 0: 1
1: 0
2: 3
3: 39
4: 255
Right 948052688 2:234990578-234990600 GCGTGGACCAGCTCTTGGTGTGG 0: 1
1: 0
2: 0
3: 4
4: 81
948052685_948052688 -2 Left 948052685 2:234990557-234990579 CCTGAAAGACTCAGCTCTGCAGC 0: 1
1: 1
2: 3
3: 25
4: 211
Right 948052688 2:234990578-234990600 GCGTGGACCAGCTCTTGGTGTGG 0: 1
1: 0
2: 0
3: 4
4: 81
948052682_948052688 22 Left 948052682 2:234990533-234990555 CCTGGGAACTCATGCGGGTCTGG 0: 1
1: 0
2: 1
3: 10
4: 107
Right 948052688 2:234990578-234990600 GCGTGGACCAGCTCTTGGTGTGG 0: 1
1: 0
2: 0
3: 4
4: 81
948052681_948052688 23 Left 948052681 2:234990532-234990554 CCCTGGGAACTCATGCGGGTCTG 0: 1
1: 0
2: 0
3: 8
4: 94
Right 948052688 2:234990578-234990600 GCGTGGACCAGCTCTTGGTGTGG 0: 1
1: 0
2: 0
3: 4
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948052688 Original CRISPR GCGTGGACCAGCTCTTGGTG TGG Intronic
900255625 1:1697134-1697156 GCGTGGGGCAGCCCTGGGTGAGG + Intronic
900264296 1:1749757-1749779 GCGTGGGGCAGCCCTGGGTGAGG + Intergenic
901889535 1:12250756-12250778 GGGTGGACCAGCTCTAAGTTAGG + Intronic
903236696 1:21955356-21955378 GCTTGGTTCAGCTCTGGGTGGGG + Intergenic
905017679 1:34788730-34788752 GCATGGTCAAGTTCTTGGTGAGG - Intronic
911884883 1:103285638-103285660 AAGTGGACCATCTCTTGGTTAGG + Intergenic
916214075 1:162381332-162381354 GAGTGGGCCAGCTCTTGCAGAGG - Intronic
917975126 1:180233399-180233421 GCGGGGACGAGCTGTCGGTGCGG - Intronic
921614833 1:217253990-217254012 GCATGGTTCAGCTCTTGTTGAGG + Intergenic
922429036 1:225528820-225528842 GCGTAGAGCAGGTCTTGTTGGGG - Intronic
923921326 1:238566940-238566962 GGGTGGACCAGATTTTGGAGAGG + Intergenic
1063057722 10:2522279-2522301 GCGTGGATCAGGTGTGGGTGTGG - Intergenic
1067028846 10:42866810-42866832 GCGTGGAACTCCTCGTGGTGCGG - Intergenic
1075797051 10:125128108-125128130 GGGTGGCCCAGCTCATGGTGAGG + Intronic
1076830882 10:132993523-132993545 CCCTGGTCCTGCTCTTGGTGGGG + Intergenic
1076877902 10:133225573-133225595 GCTTAGAACAGCCCTTGGTGAGG + Exonic
1084045422 11:66565249-66565271 GCTGGGATGAGCTCTTGGTGAGG - Intronic
1084593398 11:70103404-70103426 GCCTGCACCATCTCTTGGTGGGG - Intronic
1084858091 11:72001536-72001558 TCCTGGCCCAGCTCTGGGTGAGG + Exonic
1088096422 11:106106041-106106063 GAGTGGTCCAACTCTGGGTGTGG - Intergenic
1090352386 11:126115666-126115688 GGGTGGACAAGCTCTTGGACAGG + Intergenic
1090472265 11:126990607-126990629 TAGTGCCCCAGCTCTTGGTGCGG + Intronic
1096649357 12:53054278-53054300 GCCTGGACCCGCTCATGGAGCGG + Exonic
1099510917 12:83536272-83536294 GGGTGGATCAGGTTTTGGTGGGG - Intergenic
1100114534 12:91288125-91288147 GCCTGCAGAAGCTCTTGGTGGGG + Intergenic
1114478304 14:23013632-23013654 GCATGCACCAGCTATTGGGGAGG - Intergenic
1120970125 14:90200183-90200205 ACGTGGCCCAGCTCTTGGCCAGG + Intergenic
1121015749 14:90547974-90547996 CTGTGGCCCAGCTCTGGGTGGGG + Intronic
1123105691 14:105840140-105840162 GCCTGGGCCAGCACGTGGTGTGG + Intergenic
1124495039 15:30181220-30181242 GCTTGGACTAGCTCCTGGTTTGG - Intergenic
1124504305 15:30260229-30260251 GTGTGGCCCAGCACTTTGTGAGG - Intergenic
1124739246 15:32278406-32278428 GTGTGGCCCAGCACTTTGTGAGG + Intergenic
1124748529 15:32357425-32357447 GCTTGGACTAGCTCCTGGTTTGG + Intergenic
1129416989 15:75389588-75389610 GCGTGGCCCATCTCTAGGTAAGG + Intronic
1134202344 16:12209559-12209581 GTTTGGACCAGATCCTGGTGGGG + Intronic
1136464044 16:30429849-30429871 GCCTGGCCCAGCTCGGGGTGGGG - Intronic
1136537432 16:30908414-30908436 GCTTGGACCAGATCTTTGAGAGG - Intergenic
1141842818 16:86585031-86585053 GTGTGGACCACATGTTGGTGAGG + Intergenic
1142117280 16:88365675-88365697 GAGTGGACCCGCTCCTGGTCAGG - Intergenic
1144454341 17:15406648-15406670 CCATGGACCAGCTGGTGGTGGGG - Intergenic
1147333967 17:39715891-39715913 GTGTGGAGCAGAGCTTGGTGCGG - Exonic
1148586590 17:48785659-48785681 GCGTGGACCAGTCCTGGCTGTGG - Intronic
1153814796 18:8783093-8783115 GCCTGCACCAGGCCTTGGTGAGG + Intronic
1160695553 19:482672-482694 GCATGGAACAGCTCGTGGGGTGG - Intergenic
1163696696 19:18767990-18768012 GCCTGAGCCAGCCCTTGGTGAGG + Intronic
1163849609 19:19655718-19655740 GCGTGGGCCTGGTCTTGGGGTGG + Intronic
1165133119 19:33645601-33645623 GGGTGGAACAGCTGTTGGAGGGG + Intronic
1165354221 19:35293789-35293811 CCGGGGACCAGCTTCTGGTGAGG + Intronic
1166137090 19:40784088-40784110 TCGTGGACCAGGTGGTGGTGGGG + Intronic
1167631726 19:50629889-50629911 GCTCGGACCAGCTGGTGGTGAGG - Exonic
928582483 2:32723314-32723336 ATATGTACCAGCTCTTGGTGGGG + Intronic
936599362 2:113880828-113880850 GGGTGGACCAGCACTTCGGGAGG - Intergenic
937207454 2:120245776-120245798 GTGGGGACCAGGCCTTGGTGGGG + Intronic
941770778 2:169343443-169343465 TAGTTGACCAGCTCTTGGTTAGG - Intronic
947831616 2:233145668-233145690 GAGTGGCTCAGATCTTGGTGGGG + Intronic
948052688 2:234990578-234990600 GCGTGGACCAGCTCTTGGTGTGG + Intronic
1169228323 20:3870080-3870102 GCGGGGAGCTGCACTTGGTGGGG + Exonic
1172233020 20:33349799-33349821 ACCTGGAACAGCTCTTGCTGGGG + Intergenic
1173853053 20:46231068-46231090 GCTTGGACCAGCTGTAGGGGAGG - Intronic
1176110482 20:63408515-63408537 GAGTGGACCAGATCGTGGGGCGG - Exonic
1176309599 21:5142646-5142668 GCCTGGGCCAGCTGCTGGTGTGG - Exonic
1178084137 21:29095410-29095432 CCCTGGAACAGCTCTAGGTGAGG - Intronic
1179847461 21:44119387-44119409 GCCTGGGCCAGCTGCTGGTGTGG + Exonic
1184452756 22:44592633-44592655 GCATGGAGCTGGTCTTGGTGGGG - Intergenic
1185242792 22:49755464-49755486 GCCTGGACCAGGTCCTGGTTGGG - Intergenic
955658870 3:61275535-61275557 GCGTGTACCAGCTACTTGTGAGG - Intergenic
961029020 3:123585729-123585751 GCGTGGACTCGCTCATCGTGAGG + Intergenic
961307210 3:125966943-125966965 TAGTGGTCCAGCTCTTGGGGTGG - Intergenic
969930132 4:10622834-10622856 GCATGGTCAAGTTCTTGGTGAGG + Intronic
984667821 4:182448209-182448231 GCGTGGACCGGCCCGTGGCGGGG - Intronic
1002467775 5:179416349-179416371 GTGTGGACAAGATCTGGGTGTGG - Intergenic
1002650948 5:180693224-180693246 GTGTGGACCATTTCTTTGTGAGG - Intergenic
1004238336 6:13895693-13895715 TCCTGGACCTGCTCTTGGGGAGG + Intergenic
1009555224 6:65155337-65155359 GGGTGGCAAAGCTCTTGGTGTGG - Intronic
1011769840 6:90663284-90663306 GCATGCACCAGCACCTGGTGAGG - Intergenic
1019585056 7:1796139-1796161 CCATGGACCAGCTCTTGCTCAGG + Intergenic
1037821440 8:22137104-22137126 GTGTGGATTAACTCTTGGTGTGG - Intergenic
1040969113 8:53114539-53114561 GCGTGGACCAGCTCTGCCTGGGG + Intergenic
1042772749 8:72397130-72397152 TCCTAGATCAGCTCTTGGTGTGG + Intergenic
1048967471 8:139625087-139625109 GCATGGCCCAGCTCTCGGTGAGG - Intronic
1049694503 8:143976808-143976830 GCGCGGCGCAGCTCTGGGTGGGG - Intergenic
1058128688 9:101225466-101225488 CAGTGGACCAGCTCTTGCTTTGG - Intronic
1058937114 9:109779943-109779965 GCGTGGACACGCGCTTGCTGGGG - Intronic
1061630651 9:131870223-131870245 GCGTAGACCAGCTCTTGCACAGG - Intronic
1062218931 9:135403958-135403980 GTGTGGACCAGCTCCTGGGCGGG + Intergenic
1200229158 X:154435517-154435539 GCGTGGCCCAGCTTCAGGTGGGG + Intronic