ID: 948053641

View in Genome Browser
Species Human (GRCh38)
Location 2:234995873-234995895
Sequence GCTCCCCTGACGCCCCAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 212}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948053641_948053646 16 Left 948053641 2:234995873-234995895 CCTCCCTGGGGCGTCAGGGGAGC 0: 1
1: 0
2: 1
3: 20
4: 212
Right 948053646 2:234995912-234995934 CGCTGGCAAAAAATGTTCCAAGG 0: 1
1: 0
2: 0
3: 8
4: 114
948053641_948053647 29 Left 948053641 2:234995873-234995895 CCTCCCTGGGGCGTCAGGGGAGC 0: 1
1: 0
2: 1
3: 20
4: 212
Right 948053647 2:234995925-234995947 TGTTCCAAGGAAGCCTCAGCTGG 0: 1
1: 0
2: 2
3: 27
4: 164
948053641_948053644 -1 Left 948053641 2:234995873-234995895 CCTCCCTGGGGCGTCAGGGGAGC 0: 1
1: 0
2: 1
3: 20
4: 212
Right 948053644 2:234995895-234995917 CATTTGTCCTTGAAACACGCTGG 0: 1
1: 0
2: 1
3: 7
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948053641 Original CRISPR GCTCCCCTGACGCCCCAGGG AGG (reversed) Intronic
900413125 1:2522244-2522266 GCTCTCCTCACAGCCCAGGGCGG + Intronic
900415158 1:2531408-2531430 CCTCCCCTAAGGACCCAGGGTGG - Intergenic
900712655 1:4124292-4124314 GCTCCCCGGATGACCCAGTGTGG - Intergenic
901206606 1:7501158-7501180 TCTCCCCAGACCCTCCAGGGAGG + Intronic
901511001 1:9717980-9718002 GCTCCCTGGAGGCACCAGGGCGG + Intronic
901664144 1:10816978-10817000 GCCCCCCAGTCGCCCCAGGCAGG - Intergenic
902757102 1:18556169-18556191 CCTTCCCTGATGCCCCAGGCTGG + Intergenic
902844703 1:19100772-19100794 TCTACCCTGAAACCCCAGGGTGG + Intronic
903235602 1:21948795-21948817 GCTCCACTGTGGGCCCAGGGAGG + Intergenic
903321382 1:22545330-22545352 GCTCCTCTGACGGCCCTGGCAGG + Intergenic
904049898 1:27632817-27632839 ACTCCCCTGAGGGACCAGGGAGG - Intronic
904353961 1:29926607-29926629 TCTCCCCTGAACCTCCAGGGGGG - Intergenic
904476728 1:30769829-30769851 GCTTCCCAGAAGCCTCAGGGAGG + Intergenic
906944863 1:50286996-50287018 GCTCCCAAGACCCCCCAGAGCGG - Intergenic
907450376 1:54542362-54542384 GCTCCCCGGACGCCCCCAGCGGG + Intronic
907914264 1:58854102-58854124 GCACGCCTGATGCCCCAGGATGG - Intergenic
914086874 1:144461645-144461667 GCTCTCCTGACGCGCCGGGCGGG - Intronic
915312558 1:155011735-155011757 AGTCCCCTGACGCCCCATGAAGG - Intronic
915903014 1:159859912-159859934 CCTACCCTGAAGCCCCAGGCAGG + Intronic
917534957 1:175867822-175867844 CCTGCCCTGACACACCAGGGAGG - Intergenic
918358083 1:183724719-183724741 GCTCCCCCCAGGCCCCAGGCAGG - Intronic
920204977 1:204284627-204284649 GCTCCCCTGACGCCCCCGAGAGG + Intronic
921704967 1:218312068-218312090 TCTCCCCTGAAGCCCCAAGAGGG + Intronic
923092556 1:230751220-230751242 GCTCCCCTGACCCCCAGGAGGGG + Intronic
1066419846 10:35254739-35254761 GATCACCTGAGCCCCCAGGGAGG + Intronic
1067497645 10:46774452-46774474 GCTCCCCTGCTTGCCCAGGGCGG + Intergenic
1067597006 10:47565962-47565984 GCTCCCCTGCTTGCCCAGGGCGG - Intergenic
1070649248 10:78222948-78222970 GGTCCCCTGATGCCCCACGCTGG + Intergenic
1071518426 10:86314441-86314463 GCCTCCCTGACCCCTCAGGGTGG + Intronic
1073572619 10:104593258-104593280 GCTGCCCTGAGGTGCCAGGGAGG - Intergenic
1075697587 10:124447993-124448015 GCTCACCTGACGCCCCGGCCGGG - Exonic
1075997436 10:126890012-126890034 ACTCCCCAGACCCACCAGGGAGG + Intergenic
1076555798 10:131320695-131320717 TCTCTCCTAAGGCCCCAGGGAGG - Intergenic
1077096538 11:801465-801487 GCTCCTCAGTGGCCCCAGGGGGG + Exonic
1077459593 11:2702137-2702159 GCTCCCCTGACCTCCTGGGGAGG - Intronic
1077486642 11:2841774-2841796 GCGCCCCTGAGGCCCTTGGGGGG + Intronic
1077957008 11:7031366-7031388 GCTGCCAGGACACCCCAGGGTGG + Intronic
1080895593 11:36446661-36446683 GCTTCCCTCACTCCCCAGTGTGG - Intronic
1081811061 11:45914356-45914378 GGTCTCCTGCAGCCCCAGGGGGG + Exonic
1083615220 11:64022773-64022795 GCTCCCCTGGCTCCCCAGCCTGG - Intronic
1083780476 11:64914934-64914956 CCTCCTCTGACGGCCCAGGCTGG - Intronic
1083928051 11:65821088-65821110 GCTCCACTTATCCCCCAGGGAGG + Intergenic
1084120385 11:67065794-67065816 GCTCCACTGACCCCCAAGGAGGG + Intronic
1084285596 11:68128588-68128610 GCTCCCCAGAAGCCCCGGGGCGG - Intergenic
1087770626 11:102205946-102205968 GCTCCCCAGAGCCCACAGGGAGG + Exonic
1088923183 11:114276590-114276612 GCTCCACTCATGGCCCAGGGAGG + Intronic
1090277374 11:125429558-125429580 GCTCCCCTGACAGCCCAGCCAGG - Intronic
1090394820 11:126411960-126411982 GCTCCCCACACGCGCAAGGGAGG + Intronic
1091112479 11:132982858-132982880 GCTCCACTGAGCCCCCAGCGTGG + Intronic
1092523800 12:9297445-9297467 ACCCCTCTGAGGCCCCAGGGGGG - Intergenic
1092543498 12:9434454-9434476 ACCCCTCTGAGGCCCCAGGGGGG + Intergenic
1094509446 12:31087602-31087624 ACCCCTCTGAGGCCCCAGGGCGG - Intronic
1098024714 12:66189448-66189470 GCTCCCCCGCCGCCCCCGGCCGG - Intronic
1098504838 12:71237506-71237528 GCTCCCCTGAGGCACCAGGTAGG + Intronic
1102036300 12:109772228-109772250 CCTCTCCTGATGCCCCAGTGTGG - Intergenic
1102930384 12:116857584-116857606 ACTCCTCTAATGCCCCAGGGAGG + Exonic
1103474628 12:121209717-121209739 GCTCGCCTGTAGTCCCAGGGAGG - Intergenic
1104995083 12:132649252-132649274 GCTCTGCTGATGGCCCAGGGAGG - Intronic
1105571121 13:21603874-21603896 CCTCCCCTGACGCCCTTAGGCGG - Intronic
1107770837 13:43786606-43786628 GGAGCCCGGACGCCCCAGGGAGG + Intronic
1109936969 13:69299623-69299645 TCTTCCCTGAGGCCCCAGGTTGG - Intergenic
1113464458 13:110503941-110503963 TCTCCCCCGGTGCCCCAGGGGGG - Exonic
1113683684 13:112262745-112262767 GCTGTCCTGGGGCCCCAGGGAGG + Intergenic
1120179450 14:81328724-81328746 GCCCCCTTGCCTCCCCAGGGAGG - Intronic
1122209543 14:100165927-100165949 GCTCCCCTGACTCTCCGGGCAGG - Intergenic
1122284348 14:100641980-100642002 CCTCCCATGAAGCCTCAGGGAGG + Intergenic
1122772378 14:104103172-104103194 GCTCGCCTGACGCCCCCATGCGG + Intronic
1122907491 14:104808464-104808486 GCACACCTGGCGCCCCAGGGAGG - Intergenic
1124941782 15:34225109-34225131 GTTGCCATGACGGCCCAGGGGGG + Exonic
1127612014 15:60646327-60646349 CCTTCCCTGATTCCCCAGGGAGG + Intronic
1129963266 15:79709504-79709526 TCTCTCCTGACGGCCCATGGAGG + Intergenic
1130255881 15:82325896-82325918 GGTCCCCAGAGGCCCCAGGGAGG + Intergenic
1131180036 15:90233475-90233497 CCTCGCCTGAGGCCCCAGCGTGG - Intronic
1132725620 16:1337062-1337084 GCCCCCCAGCAGCCCCAGGGAGG - Intronic
1132881631 16:2164099-2164121 GCTCCCCTGAGACCCCAGCTCGG - Intronic
1135415221 16:22263809-22263831 GATCCTGTGAGGCCCCAGGGAGG + Intronic
1136548103 16:30966519-30966541 ACTCCCCTGCCCACCCAGGGTGG - Intronic
1139467782 16:67163439-67163461 GCTCCACTGCCAGCCCAGGGTGG - Exonic
1140893514 16:79305433-79305455 ACTCCCCACAAGCCCCAGGGAGG - Intergenic
1141139934 16:81490774-81490796 TCTACCCAGACACCCCAGGGTGG - Intronic
1141656955 16:85421648-85421670 GCACCCCCGACGCCCCCAGGTGG - Intergenic
1141866257 16:86752043-86752065 GCTCCCCTGACCCCCAAAAGGGG - Intergenic
1142110692 16:88329530-88329552 GCTCCCCAGATTCCCCAGAGGGG + Intergenic
1142366718 16:89654044-89654066 GCTCCCCGAAGGCCCCAGGCAGG - Intronic
1143119934 17:4600153-4600175 CCTCCCCAGAGGCCCCAGGCAGG - Intronic
1146668037 17:34717652-34717674 TGTCCCCTCCCGCCCCAGGGGGG + Intergenic
1147412313 17:40262563-40262585 GCTGCCCTGCAGCCCAAGGGAGG + Exonic
1147896461 17:43755004-43755026 GCTCCCTTAAAACCCCAGGGCGG + Exonic
1148218468 17:45846757-45846779 GCTCCTCCGAGGCCCCAGGGGGG - Exonic
1151018443 17:70584526-70584548 GCAACCCTGAAGCCCCAGAGGGG + Intergenic
1151474698 17:74338954-74338976 GCTCCCCTGCTGACCCAGGAAGG + Intronic
1151726974 17:75890985-75891007 GCCGCCCTGACACCCCTGGGAGG + Exonic
1152039310 17:77892761-77892783 GCCTCACTGACGCTCCAGGGTGG - Intergenic
1152040156 17:77897795-77897817 GCATCCCTGAGGCCCCAGGCTGG + Intergenic
1153947914 18:10032908-10032930 GCACCCTTCACACCCCAGGGCGG - Intergenic
1155938702 18:31781464-31781486 GGTCCTCTGATGCCCCAGGAGGG + Intergenic
1160411559 18:78678512-78678534 TCTCCCCTGGAGCCCCAGAGGGG - Intergenic
1160782888 19:885622-885644 TCTCCCCTGGAGCCCCCGGGAGG + Intronic
1160989812 19:1855872-1855894 ATTCCCGTGACACCCCAGGGTGG + Intronic
1161110766 19:2468593-2468615 GCTCCAGTGATCCCCCAGGGTGG - Intergenic
1161324829 19:3658570-3658592 GGTCCCCTGGCCTCCCAGGGAGG - Intronic
1161857343 19:6773344-6773366 GCTCCCCAGAACCCCCAGGGTGG + Intronic
1162030686 19:7916114-7916136 GCTTCTCTTCCGCCCCAGGGAGG + Intergenic
1163476945 19:17532143-17532165 GGTCCCGTGATGCCCCAGGCTGG - Intronic
1163688421 19:18725331-18725353 GCTCCCTGGAGGCCACAGGGAGG - Intronic
1165392404 19:35546034-35546056 GCGCCCCCGCCGCCCCACGGTGG + Intronic
1165758396 19:38307271-38307293 GCCCTCCTGACCCCCCAGGCCGG + Intronic
1165773333 19:38390485-38390507 CCTCCCCGCATGCCCCAGGGTGG - Intronic
1166001368 19:39879516-39879538 GGTCCCCTGAGGTCCCCGGGAGG - Intronic
1166004151 19:39895767-39895789 GGTCCCCTGAGGTCCCCGGGAGG - Intronic
1166101925 19:40576326-40576348 AATCCCCCGACTCCCCAGGGAGG - Exonic
1166356445 19:42230273-42230295 ACTCCCCTGGCCCTCCAGGGTGG + Exonic
1166509663 19:43396248-43396270 CCTTCCCTGCCGCCCCAGGCAGG - Intergenic
1166543227 19:43619381-43619403 TCTCCCAGGATGCCCCAGGGCGG + Intronic
1166566153 19:43766883-43766905 GCCCACCTGAGGCCCCAGGTGGG - Exonic
1166650475 19:44570559-44570581 GCCCCCTCGACGGCCCAGGGAGG + Intergenic
1166816463 19:45549299-45549321 CCACCCCTGACGCCGCAGTGGGG + Intronic
1167307949 19:48719782-48719804 GCTCCCGTCACACCCCAGGAAGG - Intergenic
1167321427 19:48799329-48799351 CCTCCCCTGATCCCCCAGGCTGG - Intronic
1168290489 19:55354848-55354870 GCTCCCCCGACGCCCCCTCGGGG + Exonic
925493457 2:4421302-4421324 GGTCACCTGAAGTCCCAGGGAGG + Intergenic
926143749 2:10384387-10384409 GCTCTCCTCTCTCCCCAGGGTGG - Intronic
927154245 2:20212579-20212601 GCTGCCTTGAGGCCCCAGTGAGG - Intronic
927492080 2:23527319-23527341 GCCCCCCAGCCACCCCAGGGTGG + Intronic
929789448 2:45012679-45012701 GCTTCCCTGAAGTCCCTGGGAGG + Intergenic
934739261 2:96707371-96707393 GCTCCACTGCCGCCCCTGAGTGG - Exonic
935083212 2:99819793-99819815 GCTCCCCTGACCACACAGTGTGG - Intronic
936389237 2:112056148-112056170 ACACCCCTGAGGCCGCAGGGAGG + Intronic
937143872 2:119626041-119626063 GCTCCCCTGAAACCCCTGGGGGG - Intronic
937223648 2:120356208-120356230 GCTCCTCTGAGGGCCTAGGGTGG - Intergenic
941905364 2:170713884-170713906 GCACCCCTAATGCCCCAGGGCGG + Exonic
942368588 2:175256950-175256972 GCTCGCCTGCCGCCCCAGCGCGG - Intergenic
945753547 2:213818327-213818349 GTTCCTCTGAGGTCCCAGGGAGG - Intronic
948053641 2:234995873-234995895 GCTCCCCTGACGCCCCAGGGAGG - Intronic
948140713 2:235670281-235670303 GCTCCCCGGACGCGCCCGGGAGG + Intronic
1171426421 20:25051380-25051402 GGTCCCCTCATGCCCAAGGGAGG + Intronic
1172271631 20:33658611-33658633 GTTCCCATGAGGCCCCAGGCCGG - Intronic
1172363667 20:34332605-34332627 GCGACCCTGAAGCCCCAGAGAGG - Intergenic
1172840125 20:37897791-37897813 GCTCCCCAGTCGTCCCAGTGTGG + Intergenic
1175161340 20:57010002-57010024 ACTCCCCTGATGCCCCAGGACGG + Intergenic
1175340964 20:58228692-58228714 CCCGCCCTGACGCCCCAAGGCGG + Intergenic
1175979355 20:62729270-62729292 GCTCCCTGGGAGCCCCAGGGTGG + Intronic
1176073457 20:63238224-63238246 ACTACCCTGAAGCCCCATGGAGG + Intronic
1177105207 21:16946391-16946413 GCTCCCCTTTGGCCCCAGGCAGG - Intergenic
1179175543 21:39005351-39005373 GCTCCCCTGAAGGCTCAGGGAGG + Intergenic
1179468668 21:41596095-41596117 GCTCCCCTGACGTTTCAGGCTGG + Intergenic
1180605796 22:17057955-17057977 CCTCCCGTGACACCACAGGGCGG - Intergenic
1180796152 22:18606749-18606771 GTTCCCCTGGAGCACCAGGGAGG + Exonic
1181225570 22:21388522-21388544 GTTCCCCTGGAGCACCAGGGAGG - Exonic
1181253064 22:21546291-21546313 GTTCCCCTGGAGCACCAGGGAGG + Exonic
1182057635 22:27372464-27372486 GCTCCCCAGCAGCCCCAGAGAGG + Intergenic
1183479656 22:38056617-38056639 GCCCCCCTGGGGTCCCAGGGAGG - Intronic
1183486230 22:38089063-38089085 GCCCTCCTGCCGCCCCGGGGCGG + Intronic
1183667101 22:39252449-39252471 GGTCCCCTGGTGCCCCAAGGGGG - Intergenic
1185064014 22:48621648-48621670 GCTCTCCTGATGCCGCAGGCTGG - Intronic
949946127 3:9191510-9191532 CCTTCCCTGATGCCCCAGGCAGG - Intronic
950913664 3:16621142-16621164 CCTCCCCTAACGCCCCATGGGGG - Intronic
953103337 3:39851773-39851795 CCTCTCCTGATGCCCCATGGAGG - Intronic
953411124 3:42691013-42691035 GCCCCCTTGCCTCCCCAGGGTGG - Intronic
954390942 3:50267642-50267664 GGTCCCCAGCGGCCCCAGGGTGG + Intronic
955386756 3:58486898-58486920 TCTTCCCTGACCTCCCAGGGAGG - Intergenic
958758201 3:98275146-98275168 GATTCCCTGAAGCCCCAGAGTGG - Intergenic
959672847 3:108998437-108998459 CCTCCCCTGACCCCCAAAGGTGG - Intronic
960526971 3:118721169-118721191 ACTCCACTGACACCACAGGGGGG + Intergenic
961574292 3:127822519-127822541 GCTCCCCTCCCTCCCCAGGGCGG + Exonic
962874629 3:139526399-139526421 CCTTCCCTGACCCCCCAGGCTGG - Intronic
965729328 3:171754039-171754061 CCTCCCCTGACAGCCCAGGCTGG + Intronic
968137305 3:196228419-196228441 GCTCCCCTGTCCCCTGAGGGTGG - Intronic
968573395 4:1353983-1354005 CCTCCACTCACACCCCAGGGGGG - Intronic
968870100 4:3237568-3237590 GCTCTCCAGACGCCACAGGGAGG + Intronic
969706276 4:8793994-8794016 GATGCCCTGCTGCCCCAGGGTGG - Intergenic
972627986 4:40819546-40819568 GCTCCCCTGCCGTTCCAGGGAGG + Intronic
976852216 4:89560652-89560674 GCTTCCCTGAAGCCCTAGTGTGG - Intergenic
985520559 5:372240-372262 GCTCCCCTGACTGCACAGAGGGG + Intronic
985564796 5:610123-610145 TCTCCACTGACAACCCAGGGAGG - Intergenic
985709399 5:1419870-1419892 CCTCCCAGGAAGCCCCAGGGAGG - Intronic
985765727 5:1778477-1778499 GCTCCCCTCACCCCCCTCGGGGG + Intergenic
995550497 5:113276361-113276383 GGTACCTTGATGCCCCAGGGTGG - Intronic
997199881 5:132003492-132003514 CCTCCCCTGCCGCTCCTGGGAGG - Intronic
998274285 5:140737297-140737319 GCTCCCCTGACACCACAGTGAGG - Intergenic
999751089 5:154628679-154628701 GGTTCCCTGATGCCCCAAGGGGG + Intergenic
1001018430 5:168162546-168162568 GCTCCCCTGCTTCCCCAGCGCGG + Intronic
1001382055 5:171311649-171311671 GCGCCCCGGACCCCCCAGGCGGG + Exonic
1005994661 6:30923932-30923954 GCTCCACTGCCACCCCAGAGTGG + Intronic
1006346984 6:33490666-33490688 GCTACCATGAGGCCCCAGTGTGG + Intergenic
1006458791 6:34146120-34146142 GTTCCAGTGACGCACCAGGGTGG - Intronic
1007368906 6:41413448-41413470 ACTCCCCCGGCGCCCAAGGGAGG - Intergenic
1010786222 6:80004432-80004454 GTTCCCCGGACGCCCGTGGGCGG - Intronic
1012859504 6:104542732-104542754 GCTCTACTGACCTCCCAGGGTGG + Intergenic
1014073908 6:117215257-117215279 GCTCCCCTGTGGCCCCGGGCAGG + Intergenic
1017775177 6:157675106-157675128 GCTCCCCAGAGGCCCCAGGAAGG + Exonic
1018848570 6:167572073-167572095 GTTTCCCTGACACCCCAGAGTGG + Intergenic
1018898291 6:168036415-168036437 GCTCCCCTGACTCTCTGGGGCGG - Intronic
1018901229 6:168052754-168052776 GTTCTCCAGCCGCCCCAGGGTGG - Intergenic
1018919514 6:168161550-168161572 GCTCCCCTTACCCCCCAGCCTGG + Intergenic
1019162777 6:170080333-170080355 GCTGCCCTGACGTCCCAGCTGGG - Intergenic
1019997590 7:4734610-4734632 CCCCCCATGAAGCCCCAGGGAGG - Intronic
1024993507 7:55254471-55254493 GCACCCCTGCGGCCCCAGCGCGG + Intronic
1026894265 7:74000856-74000878 CCTCCCCTGCAGCCCCAGGGCGG - Intergenic
1028121406 7:87059688-87059710 GCTCCCGTCACGCCGGAGGGAGG + Exonic
1028135506 7:87219835-87219857 GCTACCCTGGCGGCCCAGAGGGG - Intronic
1029113259 7:98224004-98224026 GCTCCGCTCCAGCCCCAGGGAGG - Intronic
1030488628 7:110203922-110203944 GCTCCCCTCAGGCCCAAGGCAGG + Intergenic
1032084146 7:128874750-128874772 GCTCCCCTGCAGCCCCAGACAGG - Intronic
1034194148 7:149233116-149233138 GCTCCCCTGACTTCCCACAGGGG + Intergenic
1034203220 7:149295291-149295313 GCACCCCTGAGGCCCGTGGGCGG - Intronic
1035565258 8:636777-636799 GCTCCCCTGAGGGGCCAGGAGGG + Intronic
1037529148 8:19757123-19757145 GCGCCACTGACGCCCCCGCGCGG + Intronic
1037707763 8:21330022-21330044 GCTCCCCTGCCACCCTAGAGGGG - Intergenic
1037947243 8:22997147-22997169 GGTCCCCAGACGGCCTAGGGTGG + Intronic
1038639475 8:29311875-29311897 GCTCCCCTGCAGCCCCTGTGCGG + Intergenic
1038828468 8:31032904-31032926 GCTCCCCCGGCGCCGCAGCGCGG + Exonic
1040530333 8:48261426-48261448 GCACCCCAGAAGCCCCAGTGTGG + Intergenic
1040915983 8:52566072-52566094 GCTCCCCTGGCCTCCCTGGGGGG + Intergenic
1046441105 8:114255399-114255421 GCTTCCCTGAAGCCCAAGGATGG + Intergenic
1047581690 8:126223326-126223348 ACTACCCTGAAGCCCCAGAGGGG + Intergenic
1049021692 8:139961525-139961547 GCTCCCCTGAGAGCACAGGGAGG - Intronic
1049225501 8:141448779-141448801 GCTCCCCTGCTACCCCTGGGTGG + Intergenic
1049459454 8:142717925-142717947 ACTCCCCAGGTGCCCCAGGGCGG + Intergenic
1056771003 9:89478415-89478437 ACTCCCCTGAGGCTCTAGGGGGG - Intronic
1056776397 9:89516176-89516198 GTGCCCTTGACACCCCAGGGGGG + Intergenic
1057200086 9:93135047-93135069 ACTCCCCTGGCCTCCCAGGGTGG - Intergenic
1060204386 9:121674079-121674101 GCTTCCCTGAGGCCCCATGGAGG + Intronic
1060678058 9:125534843-125534865 TCTTCCCTGACTCCCCAGGATGG + Intronic
1060969455 9:127730013-127730035 GCTCCTCAGAGGCCCCAAGGCGG + Intronic
1062043050 9:134412805-134412827 TCTCCCCCGACGACCCTGGGTGG - Intronic
1062211224 9:135365375-135365397 GCTCAGCTGTGGCCCCAGGGAGG - Intergenic
1187618681 X:21026913-21026935 GCTCCCCTGTGGCCCAAGGCAGG + Intergenic
1187623602 X:21086078-21086100 GCTCCCCTCTCTCCCCAGGCAGG - Intergenic
1195129559 X:101839728-101839750 GCTCCTCTGAGGGCCCAGGCAGG + Intronic
1195176680 X:102320101-102320123 GCTCCTCTGAGGGCCCAGGCAGG - Intronic
1195182184 X:102366992-102367014 GCTCCTCTGAGGGCCCAGGCAGG + Intronic
1195202548 X:102564792-102564814 GCTCCTCTGAGGGCCCAGGCAGG - Intergenic
1195254905 X:103081509-103081531 GCTCCTCTGAGGACCCAGGCAGG + Intronic