ID: 948053641

View in Genome Browser
Species Human (GRCh38)
Location 2:234995873-234995895
Sequence GCTCCCCTGACGCCCCAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 212}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948053641_948053647 29 Left 948053641 2:234995873-234995895 CCTCCCTGGGGCGTCAGGGGAGC 0: 1
1: 0
2: 1
3: 20
4: 212
Right 948053647 2:234995925-234995947 TGTTCCAAGGAAGCCTCAGCTGG 0: 1
1: 0
2: 2
3: 27
4: 164
948053641_948053646 16 Left 948053641 2:234995873-234995895 CCTCCCTGGGGCGTCAGGGGAGC 0: 1
1: 0
2: 1
3: 20
4: 212
Right 948053646 2:234995912-234995934 CGCTGGCAAAAAATGTTCCAAGG 0: 1
1: 0
2: 0
3: 8
4: 114
948053641_948053644 -1 Left 948053641 2:234995873-234995895 CCTCCCTGGGGCGTCAGGGGAGC 0: 1
1: 0
2: 1
3: 20
4: 212
Right 948053644 2:234995895-234995917 CATTTGTCCTTGAAACACGCTGG 0: 1
1: 0
2: 1
3: 7
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948053641 Original CRISPR GCTCCCCTGACGCCCCAGGG AGG (reversed) Intronic