ID: 948055076

View in Genome Browser
Species Human (GRCh38)
Location 2:235005051-235005073
Sequence CAGGGGGATCTGCAGGCGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 283
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 261}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948055076_948055087 15 Left 948055076 2:235005051-235005073 CCATCCGCCTGCAGATCCCCCTG 0: 1
1: 0
2: 1
3: 20
4: 261
Right 948055087 2:235005089-235005111 CTGCGAGGAAGCACTGCTTGTGG 0: 1
1: 0
2: 2
3: 12
4: 151
948055076_948055088 23 Left 948055076 2:235005051-235005073 CCATCCGCCTGCAGATCCCCCTG 0: 1
1: 0
2: 1
3: 20
4: 261
Right 948055088 2:235005097-235005119 AAGCACTGCTTGTGGAGAGCAGG 0: 1
1: 0
2: 1
3: 18
4: 172
948055076_948055086 0 Left 948055076 2:235005051-235005073 CCATCCGCCTGCAGATCCCCCTG 0: 1
1: 0
2: 1
3: 20
4: 261
Right 948055086 2:235005074-235005096 GGTGTTAACACAGGACTGCGAGG 0: 1
1: 0
2: 1
3: 5
4: 82
948055076_948055081 -9 Left 948055076 2:235005051-235005073 CCATCCGCCTGCAGATCCCCCTG 0: 1
1: 0
2: 1
3: 20
4: 261
Right 948055081 2:235005065-235005087 ATCCCCCTGGGTGTTAACACAGG 0: 1
1: 0
2: 0
3: 9
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948055076 Original CRISPR CAGGGGGATCTGCAGGCGGA TGG (reversed) Intronic
900030372 1:366909-366931 CACGGGGTTCTGCAGGAGAACGG + Intergenic
900051024 1:595973-595995 CACGGGGTTCTGCAGGAGAACGG + Intergenic
900114656 1:1023342-1023364 CTGGGGGCTATGCAGGGGGAGGG + Intronic
900408727 1:2503552-2503574 CAGGGGGGTCTGGAGGGGCAGGG - Intronic
900410422 1:2510149-2510171 CAGGATGACCTGCAGGAGGAGGG + Exonic
900631640 1:3639562-3639584 CAGTGGGAAATGCAGGTGGAGGG - Intronic
902291848 1:15440479-15440501 GAGGGAGATCTGCAGGAGGGTGG - Exonic
902332316 1:15736594-15736616 CAGGGGGAGCTGCAGGCCCGGGG + Exonic
902381290 1:16053625-16053647 CGGTGGGAACTGCAGGCAGAGGG - Exonic
902727899 1:18349492-18349514 CAGGAGGCGCTGCAGGCAGAAGG + Intronic
902835560 1:19044668-19044690 CAGAGGGCTCTGGAGGCGGGTGG + Intergenic
902955599 1:19922578-19922600 CAGGGGGACCTCCATGGGGATGG - Intronic
903378902 1:22883565-22883587 CACGGGGAACTGCAGATGGATGG + Intronic
905182307 1:36175026-36175048 CAAGGGGCTCTGGAGGGGGAAGG - Intronic
905471345 1:38194403-38194425 CAGAGGGTTTTGCAGGCGCAAGG - Intergenic
905795431 1:40813438-40813460 GAAGGGGATGTGCAGGGGGAGGG + Intronic
905851768 1:41280036-41280058 CAGGGGCATCTGCAGGAGAAGGG - Intergenic
905975709 1:42172230-42172252 TAGGGGAATTTGCAGGAGGAGGG - Intergenic
907492503 1:54817130-54817152 CAGCTGGAGCTGCAGGCGAAGGG + Intronic
909878633 1:80844701-80844723 CAGTGGGACCTGCTGGGGGAGGG - Intergenic
911045797 1:93626449-93626471 CAGGCTGATCTGCAGGCTGGGGG + Intronic
912853518 1:113147314-113147336 CAGGGGGCTCTGCATGGGGCTGG + Intergenic
912930664 1:113957145-113957167 CATGGAGATCTGCAAGCGGAGGG + Exonic
915129498 1:153686970-153686992 CAGGGGGATCTGCAGGGGATTGG + Intronic
916382210 1:164224530-164224552 CAGGGGGAAGGGCAGGAGGAAGG + Intergenic
916854866 1:168738822-168738844 CAGGAGGATCTCCAGGCCCAGGG - Intergenic
917478105 1:175386141-175386163 CAGGGGAGGCTGCAGCCGGAAGG + Exonic
918523025 1:185435884-185435906 CAGGTGGAACTGCAGCCAGATGG + Intergenic
920960949 1:210663657-210663679 TAGGGGAATCTGCAGGGGGAAGG - Intronic
922161552 1:223082118-223082140 CAGGCGGATTAGCAGGAGGAAGG + Intergenic
923337898 1:232985981-232986003 GATGGGGTTCTGCAGGCAGAAGG + Intronic
924029508 1:239872078-239872100 CTTGGGGATCTGCAGGTGAAAGG + Intronic
924437475 1:244054946-244054968 CAGGTGGATCTGCAGGATGTGGG - Exonic
1062791401 10:308692-308714 CAGGAGGCCCTGCAGGCTGAGGG - Intronic
1063417921 10:5889266-5889288 AAGGAGGAGCTGCAGGCGGCCGG - Exonic
1066464971 10:35642662-35642684 GTGGGTGATCTGCAGGCGGCTGG + Intergenic
1067048950 10:43001114-43001136 CAGGGTGGTGTGCAGGGGGAGGG - Intergenic
1067578912 10:47426938-47426960 CAGTGGGATCTGCTAGAGGATGG + Intergenic
1069744012 10:70703503-70703525 CAGAGGGTTCTGCAGGCCTAAGG + Intronic
1070688967 10:78510754-78510776 CAGGGGCAGCTGCAGGCAGGAGG - Intergenic
1072618033 10:97062702-97062724 CTGGGGGAGCTGCAGGCAGCAGG + Intronic
1073054568 10:100690851-100690873 CAGGAGGATGTGAAGGAGGAAGG + Intergenic
1073096311 10:100982210-100982232 CAGAGGGAGCAGCAGGCAGAGGG + Intronic
1073152322 10:101320618-101320640 CAGGGGGCTCTGAAGTTGGACGG + Intergenic
1076608867 10:131707915-131707937 CAGGGGGATCAGTGGGCAGAGGG + Intergenic
1076790687 10:132775212-132775234 CAGGGGGAGGGGCAGGGGGAGGG + Intronic
1077349629 11:2086450-2086472 CAGGGGACTCAGCAGGTGGACGG + Intergenic
1078040774 11:7860936-7860958 CAGAGGGAACAGCAGGCTGAGGG + Intergenic
1079094700 11:17502798-17502820 CAGGGGCATCCCCAGGCTGAGGG + Intronic
1080451647 11:32383163-32383185 CAGGGAGGTCTGCAGGAAGAGGG - Intergenic
1080557046 11:33427384-33427406 CAGGGGGAACTGCTGGCAGGAGG - Intergenic
1081165881 11:39808657-39808679 CAGTGGGATCTGCTGGTGGCAGG - Intergenic
1081569238 11:44279320-44279342 CAGTGGGAACTGCAGAAGGAAGG - Intronic
1083052964 11:59793254-59793276 GAGGGGGAGCTGCAGGTGCAGGG + Intronic
1083895775 11:65619031-65619053 CGGGGGGAGCTGCAGGAGGAAGG + Exonic
1084889880 11:72231437-72231459 CAGGGGGAAATGCAGGCAGTGGG + Intronic
1085046527 11:73356827-73356849 CAGGGAGACCTGCAGGTAGAGGG - Intronic
1085253103 11:75156415-75156437 CAGGGGGATCTGCAGGCCCAGGG + Intronic
1085643918 11:78210338-78210360 CAGGCGGAGCAGCAGGGGGATGG - Exonic
1087203721 11:95372322-95372344 CAGGAGGATGTGAAGGAGGAGGG + Intergenic
1087642456 11:100769825-100769847 CAGGGGGAGGTGTAGGGGGATGG + Intronic
1088974126 11:114799739-114799761 CAGAGGAATCTGCAGCCAGAGGG + Intergenic
1089085661 11:115815026-115815048 CAGGGGGAACTGGAGGCTCAAGG + Intergenic
1089336210 11:117725657-117725679 CAGAGAGGTCTGCAGGAGGAGGG + Intronic
1090462574 11:126905277-126905299 CGGGGGGAGCTGCAAGCTGAGGG + Intronic
1091239691 11:134044094-134044116 CAGAGGGAGCTGCATGGGGAAGG - Intergenic
1091671867 12:2457662-2457684 CAGGGGGCGCAGCACGCGGAAGG - Exonic
1092108472 12:5942011-5942033 CAGGATGTTCTGCAGGCTGAAGG + Intronic
1094377113 12:29801964-29801986 CTGGGGGCGCTGCAGGCGGCCGG + Intergenic
1094497503 12:30997750-30997772 CAGGGGGATCCCCAGACAGAGGG + Intergenic
1096079542 12:48824450-48824472 CAGGGGGATATGCATGTGTATGG - Intronic
1096115138 12:49051078-49051100 CAGGGGGCTTTTCAGGCCGAGGG + Exonic
1096183511 12:49564278-49564300 CAAGGGAGTCTGCAGGCAGAGGG - Intronic
1100482786 12:94995340-94995362 CAGGGGAATGTGCAGGCAGATGG + Intronic
1103948678 12:124540548-124540570 GAGGAGGATATGCAGGGGGATGG + Intronic
1104146901 12:126043192-126043214 CTGGTGGATATGCAGGCTGAAGG + Intergenic
1104732311 12:131114559-131114581 CGGGGGGGTCTGCAGGCAGTTGG + Intronic
1105811415 13:23999579-23999601 CAGGGAGATCTCCAGGCTCAGGG + Intronic
1105943629 13:25171532-25171554 CGTGGGGGTCTGCAGGAGGAAGG - Exonic
1106235558 13:27857598-27857620 CCGGGGAATCTGCAGGCAGCAGG - Intergenic
1107792735 13:44018314-44018336 AAAGGGGATCTGCTGGAGGAGGG + Intergenic
1112438562 13:99408736-99408758 CAAGGGGCTCTGCAGGCTGACGG - Intergenic
1112776232 13:102846431-102846453 CAGTGGCATCTGCAGGATGATGG + Intronic
1113582741 13:111440448-111440470 CAGGGGAAGCTGCAGGGGGCAGG - Intergenic
1113763786 13:112868247-112868269 CAGAGGGATCTGCACAGGGAGGG + Intronic
1116755812 14:48946657-48946679 CAGGAGGATGGGCAGGAGGAGGG - Intergenic
1117315598 14:54567881-54567903 CAGGGGGCTCTGTAGACCGAGGG + Exonic
1119731768 14:76955848-76955870 CAGGGACCTCTGCAGGTGGATGG + Intergenic
1120192297 14:81450325-81450347 CAGGAGGAGCTGCAGGTTGATGG + Intergenic
1120630728 14:86886841-86886863 CAGGCGGATCACCAGGCGGGTGG - Intergenic
1120877609 14:89389102-89389124 CAGGGAGAGCTGCAGCCTGAGGG + Intronic
1121402028 14:93688422-93688444 CAGCTGGAGCTGCAGGCAGAAGG + Intronic
1121712244 14:96047336-96047358 CTGGGACATCTGCAGGTGGATGG + Intronic
1122504461 14:102222743-102222765 CACGTGGAGCTGCTGGCGGAGGG + Intronic
1122616237 14:103019914-103019936 CAAGAAGAACTGCAGGCGGAGGG + Intronic
1122652398 14:103232709-103232731 CAGTGGGAGCAGCAGGGGGATGG + Intergenic
1122695347 14:103549625-103549647 CAGCGGCCTCTGCAGGCGCAGGG + Intergenic
1122910609 14:104826132-104826154 CAGGGGGATATGCGGGGGGTGGG + Intergenic
1124959148 15:34382105-34382127 CAGGGGGAGCTGCAGGGCTATGG - Intronic
1124975774 15:34528326-34528348 CAGGGGGAGCTGCAGGGCTATGG - Intronic
1128733598 15:70036957-70036979 CAGGAGGGTCAGCAGGTGGAGGG - Intergenic
1129653873 15:77510090-77510112 CAGGGGCATCTGCGGGTGTATGG + Intergenic
1129991285 15:79965588-79965610 CAGGGGGATTTGCTGATGGATGG + Intronic
1132338855 15:101065597-101065619 CCTGGAGATCTGCAGGCGGCTGG + Exonic
1132626616 16:894440-894462 CAGGGGGATGGGTGGGCGGACGG - Intronic
1132661496 16:1063379-1063401 GAGGGGGATCAGCAGGGGAAGGG + Intergenic
1132885841 16:2181624-2181646 CAGGTGGACCAGGAGGCGGAGGG + Intronic
1132891310 16:2206175-2206197 CAGCGGCATCTGCACCCGGACGG + Exonic
1133241411 16:4416396-4416418 CAGGGGGAGGGGCAGCCGGACGG + Intronic
1134081025 16:11325083-11325105 CAGGGGGAAGAGCAGGCAGAAGG + Intronic
1136156096 16:28383263-28383285 CAGGTTGATGTGCAGGTGGAAGG + Exonic
1136206990 16:28732025-28732047 CAGGTTGATGTGCAGGTGGAAGG - Exonic
1137778077 16:51073164-51073186 CAAGGGGATCTGCATGCTGGAGG + Intergenic
1137829055 16:51526477-51526499 CAGGGGTATCTGAACGCGGGTGG - Intergenic
1138369761 16:56517408-56517430 CAGAGGGATCTGCAGGTGCAAGG - Intronic
1139347606 16:66314319-66314341 CTGGGGGAACTGGAGGCTGATGG - Intergenic
1139942044 16:70612336-70612358 TAGGGGGATCTGCTGGTGAATGG + Intronic
1140608117 16:76565017-76565039 CAGGGAGATCTGCAGGGAAAAGG - Intronic
1141278880 16:82612869-82612891 CATGGGGAGATGCAGACGGAGGG + Intergenic
1141900470 16:86987305-86987327 CGGGGGCATATGCAGGCTGAGGG + Intergenic
1142128594 16:88422161-88422183 CAGGTGGATGGGCAGGAGGATGG + Intergenic
1142196817 16:88742805-88742827 CAGTGGGGGCTGCAGGTGGATGG + Intronic
1142239372 16:88938232-88938254 CTGGGGGATCTGGTGGCTGAGGG - Intronic
1142265163 16:89061097-89061119 GAGGGGGATTTGCAGGAGGAGGG - Intergenic
1145056650 17:19707658-19707680 CAGGGTGGTCAGCAGGCAGAGGG - Intronic
1146554505 17:33812178-33812200 CAGAGGGATCAGCAGGGTGACGG + Intronic
1146914838 17:36671966-36671988 GAGGAGGATCTGCAGGGGGCAGG - Intergenic
1148832226 17:50441032-50441054 CTGGGGGCCCTGCAGGCTGACGG - Intronic
1148921462 17:51038691-51038713 CATGGGGATGTGCAGGTGCATGG - Intronic
1151335573 17:73437814-73437836 GAGGCGGTTCTGCAGGAGGAAGG + Exonic
1151941000 17:77291955-77291977 CAGGGGGACCAGCAGACTGAGGG - Intronic
1152260138 17:79262361-79262383 CAGTGGGATCTGCTTGCGCAGGG - Intronic
1152923982 17:83079406-83079428 CGGGGGGCGCTGCAGGAGGAGGG - Intergenic
1152949387 17:83219648-83219670 CACGGGGTTCTGCAGGAGAACGG - Intergenic
1153816840 18:8798142-8798164 CAGGGGGGTCACCAGGCGGATGG + Exonic
1156052887 18:32959186-32959208 CTGAGGGATCTGCAGGGGAAAGG + Intronic
1156586412 18:38436022-38436044 CAGGGGCAGCTGCAGGTGTAAGG - Intergenic
1157626614 18:49056063-49056085 CTGGGGGAGGTGCAGGCTGAAGG + Intronic
1158505728 18:58044568-58044590 CGGGGGGACCTGGAGGCAGAGGG + Exonic
1158552294 18:58446354-58446376 CAGGGGGGTCGGCAGGCGCCGGG - Intergenic
1158646731 18:59254964-59254986 GAGGGGGAGCGGGAGGCGGAGGG - Intergenic
1161327333 19:3670121-3670143 CAGGAGCCTCTGCAGGCGGCAGG + Intronic
1161964403 19:7540324-7540346 CAGGGGCTGCTGCAGGAGGATGG + Intronic
1162052694 19:8044304-8044326 CAGGGGGACCTGCAGCTGAATGG - Intronic
1162531301 19:11237794-11237816 CTGGGGGATCTGCTGGGGGCTGG + Intronic
1163510885 19:17734259-17734281 CAGGGTCACCTGCAGGTGGAGGG - Exonic
1165939380 19:39407612-39407634 CAGGGGTTTCTGCGGGCGGGTGG + Intronic
1166102775 19:40580897-40580919 CTATGGGCTCTGCAGGCGGAAGG + Exonic
1166593916 19:44027602-44027624 CAGGGGCATCAGCAGGGAGAAGG - Intronic
1166679689 19:44759028-44759050 CTGGGGGGTCTGAAGGAGGAGGG - Intronic
1166822577 19:45589574-45589596 CAGAGGGAACTGCAGGTGCAAGG - Intronic
1167382943 19:49149134-49149156 CGTGGGGATCTGCAGGAGCAAGG - Exonic
1167410351 19:49340427-49340449 CAGGGGAATGTGAAGGCGGAGGG - Exonic
1167668946 19:50838837-50838859 CTGGGGGATCTGAGGGAGGAGGG + Intergenic
1168295171 19:55374609-55374631 GAGGGGGCTCTGCAGGGGGCCGG - Intergenic
925069638 2:956268-956290 CAGGGGGAGGTGCAGGGGCAGGG - Intronic
925169172 2:1740489-1740511 CTGGGGGGCCTGCAGGCGGGAGG + Intronic
927217429 2:20675934-20675956 CAGGAGGAACTGCAGCTGGATGG - Intergenic
927217450 2:20676036-20676058 CTGGGGCCTCTGCAGGCAGAAGG + Intergenic
927884385 2:26709732-26709754 CATGGGTCTCTGCAGGGGGAGGG - Intronic
932573137 2:72948723-72948745 CAGGGGGAGATGCAGGCAGTGGG + Intronic
933788419 2:85863328-85863350 CAGGGGGATCTACAGTCCCAGGG + Intronic
933977974 2:87527394-87527416 CAGTGGGGTCTGCAGCAGGAAGG - Intergenic
935200648 2:100853742-100853764 CAGGGGCATCTGCAGCCAGGTGG + Intronic
935217856 2:100988812-100988834 CAGGGGGACCTGGAGGAGCAGGG - Intronic
937439690 2:121905428-121905450 TACGGGGATCTGCAGGTGGCTGG + Intergenic
938322260 2:130373058-130373080 CAGGAGGACCTGGAGGCGGGGGG + Intronic
939990727 2:148875386-148875408 CAGGCCGGTCTGCAGCCGGAGGG + Exonic
945044932 2:205773632-205773654 CAAGGGGACCTGCTGGAGGAAGG - Intronic
946037682 2:216756702-216756724 CAGGGGGAGCTGCCGGAAGAAGG + Intergenic
946423979 2:219582349-219582371 CAGGGCAATCTGGAAGCGGAAGG + Intergenic
946966565 2:225042745-225042767 CCGGGGGAACTGCAGGCTGCGGG + Intergenic
947428661 2:230006695-230006717 CAGGCAGATCTGCAGGCACATGG + Intronic
947526181 2:230878102-230878124 CAGGGGGTTCTGGGGGAGGAGGG - Exonic
947634878 2:231674915-231674937 CAGAGGGGTTTGCAGGCTGACGG - Intergenic
947722939 2:232380341-232380363 CAGGGGGCACAGCAGGGGGAGGG + Intronic
948055076 2:235005051-235005073 CAGGGGGATCTGCAGGCGGATGG - Intronic
948237670 2:236402593-236402615 CAGGGGGAGCTGCAGCCAGCGGG + Intronic
948265520 2:236632848-236632870 CAGGGGGTAGTGCAGGCAGAAGG + Intergenic
1168998711 20:2151098-2151120 CAGGGGGCACTGCAGGCTGAGGG - Intronic
1169208383 20:3752532-3752554 CAGGAGGAGCCGCAGGAGGAAGG + Exonic
1171030023 20:21668935-21668957 TAGGGAGATCTGCAGCAGGACGG + Intergenic
1172422497 20:34829079-34829101 CAGGGGGATCAGCATGTGCAAGG - Intergenic
1173838398 20:46140288-46140310 CATGGGGCTCTGCAGGGGGCGGG + Intergenic
1174253240 20:49234995-49235017 CAGGAGGATGTGCATGCGGTGGG - Exonic
1175824855 20:61931300-61931322 GAGAGGGAAGTGCAGGCGGAGGG - Intronic
1175901853 20:62363084-62363106 AAGGGGGAGCTGCAGACAGAAGG + Intronic
1175909016 20:62395766-62395788 CAGGGGGAGCTCCAGAAGGAAGG + Intronic
1176239575 20:64069689-64069711 CAGGGTGTTTTGCAGGCAGAAGG + Intronic
1177431609 21:20997869-20997891 ATGGGGGATCTGGAGGCGGGCGG - Intergenic
1178005647 21:28217279-28217301 CAAGAGGATCTGATGGCGGAAGG - Intergenic
1179175502 21:39005096-39005118 CAGGGGGATTGGCAGGAGGGTGG + Intergenic
1179486219 21:41712365-41712387 GAGGGGGACCTGCAGGGGGAGGG + Intergenic
1179902033 21:44399377-44399399 CAGGGCGAGCTGCAGGCAGGTGG - Exonic
1180065580 21:45410487-45410509 CAGTGGGAACGGCAGGAGGAGGG + Intronic
1180877713 22:19182540-19182562 CTGGAGGCTCTGCAGGCGGCAGG + Intronic
1181042637 22:20199502-20199524 CAGGTGGATGGGCAGGTGGATGG - Intergenic
1182444212 22:30380775-30380797 CAGGAGGAAGTGCAGGAGGATGG - Intronic
1183043118 22:35198231-35198253 CATGGGGAGATGCAGGTGGAAGG - Intergenic
1183350739 22:37333308-37333330 CAGGGGAATCTGCAGCCAGCCGG - Intergenic
1183386806 22:37519554-37519576 CAGGGGGAGGCGCAGCCGGACGG - Intergenic
1183715817 22:39532822-39532844 CAGAGGGATCCGGAGGGGGATGG + Exonic
1185277714 22:49956950-49956972 CAGGTGGATCGGCAGGAGGGAGG + Intergenic
1185309445 22:50146015-50146037 CAGTGGGATGGGCAGGCAGATGG + Intronic
1185340245 22:50287785-50287807 CGGGTGCATCTGCAGGCGCAGGG + Exonic
950457546 3:13101631-13101653 CAGGCTGGGCTGCAGGCGGAAGG + Intergenic
951104360 3:18725736-18725758 GAGGGGGATGTGGAGGCGGAGGG + Intergenic
953391222 3:42534989-42535011 CAGGGGGATCAGCAGGAGTGTGG - Exonic
957176801 3:76821740-76821762 CAGTGGCATCTGCAGGCAGAGGG + Intronic
961219396 3:125187763-125187785 CAGGGGAATCAGCATGAGGAGGG - Intronic
961488243 3:127232510-127232532 CAGGGAGGTCAGCAGGAGGATGG - Intergenic
961648068 3:128403226-128403248 CAGGTGGGTCTCCAGGCAGAGGG + Intronic
964881974 3:161432871-161432893 CAGGGGGTTGTGCCGGCGGATGG + Intergenic
966926436 3:184647575-184647597 CAGGGGGATCTGGAGGCTACGGG - Intronic
968056594 3:195696803-195696825 CAGTGGGATGTGCAGTGGGAGGG - Intergenic
968945432 4:3661151-3661173 CAGGGGGGTCTGCAGGCTGGAGG + Intergenic
969404929 4:6984885-6984907 CAGTGGTGTCTGCAGGCGGGTGG + Intronic
973588170 4:52413000-52413022 CAGTGGGATATTCAGGCAGAGGG - Intergenic
978339836 4:107710562-107710584 CAGGGGCATATGCAGGTGAAAGG + Intronic
979913844 4:126405192-126405214 CAGAGAGATCTGCAGGCAAATGG + Intergenic
984843585 4:184091254-184091276 CAGGGTGATGTGCATGCTGAAGG - Exonic
988906378 5:35794903-35794925 GAGGGGGACCTGAGGGCGGAAGG - Intronic
990314097 5:54567850-54567872 CAGTGGGCTCTGAAGGTGGAGGG - Intergenic
996509015 5:124298352-124298374 CAGGGGGAATTGCAGGCAGGTGG + Intergenic
997585420 5:135040439-135040461 CTGGGGGATGTGCAGGCATAGGG - Intronic
997691592 5:135831077-135831099 GAGAGGGAGCTGCAGGTGGAGGG + Intergenic
1001628880 5:173159987-173160009 CATGGGGATCAGCAGGATGATGG + Exonic
1002427918 5:179186736-179186758 GAGGGGGATGTGCAGGAGGCAGG - Intronic
1002743617 5:181453463-181453485 CACGGGGTTCTGCAGGAGAACGG - Intergenic
1003022620 6:2524324-2524346 CAGAGGGCACTGCAGGAGGAAGG - Intergenic
1003427846 6:6009120-6009142 CAGGTGGATAAGCAGGAGGAAGG - Intergenic
1012544765 6:100405825-100405847 CAGGGTGATGTGCAGCTGGAAGG + Intronic
1016239401 6:141911069-141911091 CAGAGAGATCTGCAGGAGGTTGG + Intergenic
1018181437 6:161226793-161226815 CAGGAGGGTCTGCAGGCAGAAGG + Intronic
1018840242 6:167511344-167511366 CAGGGGGAGCTACAGGAGGCAGG - Intergenic
1019248476 6:170726692-170726714 CACGGGGTTCTGCAGGAGAACGG - Intergenic
1019360454 7:601933-601955 CAGGGGGATGGGGAGGGGGAAGG + Intronic
1023939671 7:44761512-44761534 CAGGTTGTGCTGCAGGCGGAAGG - Exonic
1029039290 7:97556069-97556091 AAGAGTGAACTGCAGGCGGATGG - Intergenic
1029593880 7:101526428-101526450 CAGAGGGGTCTGCAGGCAGAGGG - Intronic
1030247688 7:107402702-107402724 CAGGAAGAGCTGCAGGTGGATGG + Intronic
1031185873 7:118479713-118479735 AAGGGAGATCTTCAGGCAGAAGG - Intergenic
1031886951 7:127253210-127253232 GAGGGGGATCCGCGGGCCGAGGG - Exonic
1034280526 7:149850808-149850830 CAGGTGGATCAGAAGGAGGAAGG + Intronic
1034817415 7:154184321-154184343 CAGGGGGATCCGCTGGCAGGGGG + Intronic
1035355383 7:158273461-158273483 CAGGGGGAGCCGCAGGCACAGGG + Intronic
1035355389 7:158273479-158273501 CAGGGGGAGCCGCAGGCACAGGG + Intronic
1035355408 7:158273553-158273575 CAGGGGGAGCCGCAGGCACAGGG + Intronic
1035355588 7:158274375-158274397 CAGGGGGAGCCGCAGGCACAGGG + Intronic
1035499571 8:80644-80666 CACGGGGTTCTGCAGGAGAACGG + Intergenic
1035642761 8:1196604-1196626 CAGAGGCATCTGCAGGTCGAGGG + Intergenic
1035643414 8:1200569-1200591 CAGTGGGACGTGCAGGCGGGAGG - Intergenic
1035767771 8:2120492-2120514 CAAGGGGATTTGCAGGAGGATGG + Intronic
1035781596 8:2232379-2232401 TAGGGGGGTCAGCATGCGGAGGG + Intergenic
1036148307 8:6275122-6275144 CAGGGGGCTCTGCAGCCAGCTGG - Intergenic
1036650407 8:10638736-10638758 AAGGGGGCTCTCCAGACGGAGGG + Intronic
1040341867 8:46445135-46445157 CAGGGGGATGTTGAGGCAGAAGG - Intergenic
1040495591 8:47962193-47962215 CAAGTGGATCTGCAGTCTGACGG + Exonic
1041648489 8:60277885-60277907 AAGGGGAATCTGAAGGAGGAAGG + Intronic
1044725479 8:95191189-95191211 CAGGGTGACATGCAGGTGGATGG + Intergenic
1048265720 8:132983936-132983958 CAGTGGGATGTGCAGGAGCAAGG - Intronic
1049237168 8:141518202-141518224 CCGCGGGACCTGCGGGCGGAGGG - Exonic
1049588307 8:143441877-143441899 CAGTGGGCTCTGCAGGGTGAGGG - Intronic
1051722731 9:20055140-20055162 CAAGGGGATGTGTAGGTGGATGG - Intergenic
1053292227 9:36888771-36888793 CAGGCAGCTCTGCAGGCGGCAGG + Intronic
1055056440 9:72028598-72028620 CAGGGGGATTTGCTGTGGGAAGG - Intergenic
1058963075 9:110009802-110009824 CATGAGGATCTGCAGGGAGAGGG - Intronic
1060182806 9:121545802-121545824 CCGGGTGTTCTGCAGGCGGGAGG + Intergenic
1061038265 9:128125409-128125431 CAGGGTCAGCTGCAGGCGGCTGG + Exonic
1061230142 9:129311122-129311144 CTGGGGGATCTGCATGCTCATGG + Intergenic
1061390487 9:130314953-130314975 CTGGGGGAGCAGCAGGCGCAGGG + Intronic
1061418044 9:130458614-130458636 CAGAGGGAGATGGAGGCGGAGGG + Intronic
1061465821 9:130778651-130778673 CTGGGGGATCTGAAAGTGGATGG - Intronic
1061678463 9:132231155-132231177 GAGGGGCATCTGCAGGAGGTGGG + Intronic
1062212185 9:135371150-135371172 CAGGGGGAGCTGGAGGCAGGAGG - Intergenic
1062438263 9:136556712-136556734 CAGGGGGATCCGCGGGTGGCAGG + Intergenic
1062482509 9:136759164-136759186 CTGGGGGAGCTGCAGGAGGCCGG - Intergenic
1062501887 9:136855240-136855262 CAGGAGGATCTGAGGGCAGAGGG - Exonic
1203609436 Un_KI270748v1:83956-83978 CACGGGGTTCTGCAGGAGAACGG - Intergenic
1190159522 X:48021316-48021338 CAGTGGTATCTCCCGGCGGAGGG - Intronic
1198341283 X:135715857-135715879 CAGTGGGATCTGTTGGGGGAGGG - Intronic
1198890336 X:141387828-141387850 CAGGGGGAGTTGAAGGAGGAGGG - Intergenic
1201413999 Y:13729636-13729658 CTGGGGGATGGGCAGGGGGAAGG - Intergenic