ID: 948060347

View in Genome Browser
Species Human (GRCh38)
Location 2:235038876-235038898
Sequence CAGGTACATGATGTAGTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 122}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948060347 Original CRISPR CAGGTACATGATGTAGTGGT TGG Intronic
901568667 1:10141247-10141269 CAGGTTCATGATCTTGAGGTGGG + Intronic
901741215 1:11343175-11343197 CATGTAGATGATCTAGGGGTAGG + Intergenic
902134839 1:14296241-14296263 CAGGCAAATGCTGCAGTGGTGGG + Intergenic
904462489 1:30688503-30688525 CAGGTACATGGTGTGGGGGTTGG - Intergenic
906318791 1:44804260-44804282 CTGGTACATGCTGCTGTGGTGGG + Intronic
907821213 1:57971443-57971465 AAGGTACATGGTGTAGTGTGAGG + Intronic
908752675 1:67439616-67439638 GAGGTACATGGGGCAGTGGTAGG - Intergenic
910070864 1:83212267-83212289 CAGCTACATCATATGGTGGTTGG - Intergenic
910239241 1:85068729-85068751 CAGGTACGGGAGGTAGTGGCTGG - Intronic
910976572 1:92912779-92912801 TAGATACATGATGTTGTGGCTGG - Intronic
915593170 1:156881963-156881985 CAGGTCCATGGAGTAGGGGTAGG - Intergenic
918143578 1:181737536-181737558 CAGGTTCACGATGTAGTGGCAGG - Exonic
918785983 1:188764043-188764065 CTGGTACATCTTGTAGTGCTAGG - Intergenic
919764034 1:201114968-201114990 CAGGTACTTTATGTAGCGGATGG + Exonic
923965923 1:239139018-239139040 CAAGCACAGGATGTTGTGGTGGG + Intergenic
1067345215 10:45433325-45433347 CAGGTGCATGTTGCAGTGGGCGG + Intronic
1068542127 10:58306669-58306691 CAGATATATCAGGTAGTGGTAGG - Intergenic
1068617713 10:59138001-59138023 CAGGGATATGATGTAGAGTTTGG - Intergenic
1069474279 10:68719510-68719532 AAGGTTCTTGAAGTAGTGGTAGG + Intergenic
1069831420 10:71284492-71284514 CAGGTAGAAGATGCATTGGTGGG + Intronic
1069889823 10:71645874-71645896 CGGGGAGATGATGAAGTGGTGGG - Intronic
1074503226 10:114044410-114044432 CAGGGACATGATGAAGAGGTTGG - Exonic
1077356200 11:2119930-2119952 TAGGTAGATGATGGAGTGGGTGG - Intergenic
1077872021 11:6270530-6270552 CAGGTACCTGAAGTAGGAGTAGG - Intronic
1078733988 11:14002910-14002932 CAGAGAAATGAGGTAGTGGTTGG - Intronic
1084784709 11:71435495-71435517 CATGTAGATGATGTAGAAGTAGG + Exonic
1089478958 11:118790512-118790534 CAGGGACATGCTGTATTGGAGGG - Intronic
1093727558 12:22532583-22532605 AAGGCACATTCTGTAGTGGTTGG - Intronic
1097524278 12:60710879-60710901 CAGGTAGAAGCTGTAGAGGTTGG + Intergenic
1098983365 12:76984362-76984384 CATCCGCATGATGTAGTGGTTGG + Intergenic
1101522996 12:105502345-105502367 CAGGAACATGAAGCAGTGATAGG - Intergenic
1101598937 12:106191588-106191610 CAGGTGGATGATGGAGAGGTAGG + Intergenic
1101773777 12:107775568-107775590 CAGGTGCTTGATGTAGTCGATGG - Exonic
1104436327 12:128759878-128759900 CAGCCACATAATGTAATGGTAGG - Intergenic
1105707487 13:22977181-22977203 CAGGAACATGCTGTAGGGCTAGG + Intergenic
1105910187 13:24857161-24857183 TAGGTATATGATGAAGTAGTTGG + Intronic
1107006602 13:35619505-35619527 CAGATACAGGATGTTGTGGTTGG - Intronic
1107838249 13:44429600-44429622 CAGCTATAAAATGTAGTGGTAGG + Intergenic
1109520859 13:63508790-63508812 CAGGGACATGATGGAGTTGAAGG - Intergenic
1110028053 13:70568275-70568297 CATGTACATGCTGAAGTAGTAGG + Intergenic
1112416493 13:99207400-99207422 AAGGTACATGATAGAGTTGTTGG - Intronic
1113780116 13:112971943-112971965 CATGTACATGCTGTAGTTGGAGG - Intronic
1114414274 14:22529590-22529612 CAGGTACATGAGGTATTTGCAGG + Intergenic
1115518158 14:34206031-34206053 GAGGTAAAGGATGTAGTGGGGGG - Intronic
1115989977 14:39141415-39141437 CAGGTGCATGGTGCAATGGTAGG + Intergenic
1118098354 14:62565579-62565601 CAGGTAAATGAAGTAGTAGGTGG + Intergenic
1119826782 14:77663432-77663454 CAAGTACAAGGTGTAGTGGGAGG - Intergenic
1122073239 14:99218971-99218993 CAGGTCCAAGATGGAGGGGTCGG - Intronic
1122836908 14:104434961-104434983 CAGGAACATGCTGTAGGGCTAGG + Intergenic
1130832157 15:87611965-87611987 CAGTTACATGCTGAAGTGCTGGG + Intergenic
1131117306 15:89803263-89803285 CAGGTAGATGGTGTTCTGGTAGG + Exonic
1132189994 15:99846258-99846280 CAGGTACACAATGGAGAGGTAGG - Intergenic
1133504735 16:6400135-6400157 CATGTGCATGCTGTAGTTGTTGG - Intronic
1135898938 16:26437986-26438008 CAGGTACAACAAGTAGTTGTTGG - Intergenic
1137472671 16:48775940-48775962 CAGGTACATCATATAGTGAAAGG - Intergenic
1140890076 16:79277621-79277643 CAGGGAGATGAAGTAGTGGATGG + Intergenic
1141236264 16:82220295-82220317 CTGGCACATGATGTAGAAGTTGG - Intergenic
1144779446 17:17800501-17800523 CAGGGACAGGATGGGGTGGTCGG - Intronic
1147669697 17:42169869-42169891 CAGGTTCATGACCTAATGGTGGG - Intronic
1148683170 17:49486214-49486236 CAGGTACAGGAAGTGGTGGGAGG + Intergenic
1151139692 17:71979540-71979562 AAGTTACCTGGTGTAGTGGTGGG + Intergenic
1152365708 17:79855187-79855209 GAGGCTCATGATGAAGTGGTTGG + Intergenic
1155080073 18:22400434-22400456 CAGCTACATGATCTTGGGGTAGG + Intergenic
1155263944 18:24073338-24073360 CAGCTAGATGAGGTAGTGGAAGG - Intronic
1155368183 18:25070398-25070420 TAGGTACATGGTCTAGTGTTTGG - Intronic
1156464956 18:37342890-37342912 CAGGGACATGACATAGGGGTTGG - Intronic
1157298166 18:46460925-46460947 CAGGTTCATGATGGAGAGGCAGG - Exonic
1159097027 18:63914771-63914793 CAGGTACATGCAGGTGTGGTAGG + Intronic
1160368070 18:78346463-78346485 TAGGAACATTATGTGGTGGTTGG + Intergenic
1162431448 19:10631294-10631316 CAGGTACGTGAGGTAGCGGTCGG - Exonic
1166090040 19:40502931-40502953 CAGGTACAAGGTGTAGGGCTTGG + Exonic
925766029 2:7236187-7236209 CAGTTACATGAAGAAGGGGTTGG - Intergenic
935260657 2:101353000-101353022 GATCTACATTATGTAGTGGTAGG + Intronic
937338996 2:121079054-121079076 CAGGCACATGCGGTAGGGGTTGG + Intergenic
939044370 2:137232617-137232639 GAGATACATGCTGCAGTGGTGGG + Intronic
941735581 2:168971853-168971875 CAGGTCCATGATGAAGTTGTAGG + Exonic
942784750 2:179688175-179688197 CAGGTATATGAGTTAGAGGTGGG + Intronic
944507425 2:200426933-200426955 CAGACACAGGATGTAGTGATAGG + Intronic
947562213 2:231165760-231165782 AAGGTACAAGAGGTAGTGGTCGG - Intronic
948060347 2:235038876-235038898 CAGGTACATGATGTAGTGGTTGG + Intronic
1169657188 20:7938234-7938256 CAGCTACATGATGCAGTGTGAGG + Intronic
1175907731 20:62389624-62389646 CAGGTTTATAAGGTAGTGGTAGG + Exonic
1181743911 22:24942614-24942636 CAGGGATATGGTGGAGTGGTTGG - Intronic
950315279 3:11996509-11996531 CGGGTTCATGATGGAGGGGTTGG + Intergenic
950430639 3:12948994-12949016 CAGGTACAAGATGCCGTGGTGGG + Intronic
956177905 3:66490794-66490816 CAGGTAGATTATGGAGTGTTCGG - Intronic
959608348 3:108266567-108266589 CAGGCAAATTATTTAGTGGTTGG - Intergenic
959762095 3:109977745-109977767 CAGGTACCAGATATGGTGGTTGG - Intergenic
961202119 3:125053665-125053687 CAGGTATATGAGGTACTGGAAGG - Intronic
964268036 3:154922073-154922095 CAGGTAGATGAGGTAATGTTTGG - Intergenic
965576963 3:170227309-170227331 CAGGCACATGATGCTGTCGTAGG + Intronic
976155397 4:82138967-82138989 CCTGTATATGATGTTGTGGTGGG - Intergenic
983679752 4:170339754-170339776 GAGGTACAAGCTGGAGTGGTGGG - Intergenic
983776624 4:171615790-171615812 CTGGAACATGATGTATAGGTGGG + Intergenic
984009065 4:174348509-174348531 CAGGAACTTGATATAATGGTTGG - Intergenic
985821232 5:2161380-2161402 CAGGTATATGATGGATTGGAGGG - Intergenic
987074559 5:14368763-14368785 CATGTCCATGTCGTAGTGGTTGG - Exonic
987294577 5:16538622-16538644 AAGGTACATGGTGTCTTGGTAGG - Intronic
988339018 5:29944831-29944853 AATGCACATGATGTACTGGTGGG - Intergenic
991962901 5:72063500-72063522 CAGTCACATGAGGTAGAGGTGGG + Intergenic
994116947 5:96071517-96071539 CTGGTCCATGAAGTATTGGTAGG - Intergenic
995493328 5:112715074-112715096 CATATACATGCTTTAGTGGTAGG - Intronic
997174307 5:131758413-131758435 AAGGAACATGATGAAGTGGAAGG - Intronic
997348078 5:133208262-133208284 CAGGTAAATGATGTCTTGCTTGG + Intronic
999507510 5:152213457-152213479 CATGTACATGAAGAAGTAGTAGG - Intergenic
1003641479 6:7878917-7878939 CAGGAACCTGATGTAGCTGTTGG + Intronic
1004014738 6:11721696-11721718 CATGTACATGAGGTAGTTGAGGG + Intronic
1010007917 6:71015591-71015613 GAGGTCCATGATGTAATGCTGGG + Intergenic
1015598161 6:134886278-134886300 CAGGTACAAGATCTAGTGCTAGG - Intergenic
1016373702 6:143399218-143399240 CATGTATGTGATGAAGTGGTGGG + Intergenic
1016869632 6:148803941-148803963 CAGGGAGATGATGGAGTGCTAGG - Intronic
1017258030 6:152356637-152356659 CATGTACATGGTGTAGGGATTGG - Intronic
1023042075 7:36180852-36180874 CAGGTGCATGATGAGGGGGTGGG - Intronic
1023648770 7:42346813-42346835 AAGCTACATGATGTTGTGTTTGG + Intergenic
1024246718 7:47476312-47476334 CAGGCACAGAATGTAGTGGTAGG - Intronic
1027288586 7:76677132-76677154 CAGCTACATCATATGGTGGTTGG - Intergenic
1033731780 7:144187530-144187552 CAGGTACAAGATGTGATGCTTGG - Exonic
1033742629 7:144286113-144286135 CAGGTACAAGATGTGATGCTTGG - Intergenic
1033751274 7:144363501-144363523 CAGGTACAAGATGTGATGCTTGG + Exonic
1033781488 7:144675631-144675653 CATGTACCTGATGTAGTTTTAGG - Intronic
1037740074 8:21601764-21601786 CAGGAACATTCTTTAGTGGTCGG - Intergenic
1046834437 8:118783624-118783646 CAGTGACATTAAGTAGTGGTTGG + Intergenic
1051685957 9:19658401-19658423 CAAGTTCATAAGGTAGTGGTGGG + Intronic
1053590963 9:39514191-39514213 CATGACCATGATGTAGTCGTGGG + Intergenic
1053848811 9:42269559-42269581 CATGACCATGATGTAGTCGTGGG + Intergenic
1054575343 9:66851099-66851121 CATGACCATGATGTAGTCGTGGG - Intergenic
1056329095 9:85507208-85507230 TAGGTACATGGGGTGGTGGTGGG - Intergenic
1057256317 9:93550574-93550596 CAGGTACATGGTGCAGTGGCCGG + Exonic
1062564557 9:137158456-137158478 CAGGTTCATGATGCTGTAGTTGG - Exonic
1186203984 X:7182268-7182290 CATGTGCATGCTGTAGGGGTGGG + Intergenic
1189370568 X:40425331-40425353 CTGGTACAGGATGTTATGGTGGG - Intergenic
1190723678 X:53172178-53172200 CTGGAGCATGATGTGGTGGTGGG + Intergenic
1191084189 X:56546852-56546874 CAGGGGCATGATGCAGTGGGAGG - Intergenic
1197617794 X:128714525-128714547 CAGGTAAATGATGGAGTAGGTGG - Intergenic