ID: 948060645

View in Genome Browser
Species Human (GRCh38)
Location 2:235041371-235041393
Sequence GGCTGAGCTGGATTCGGTGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 127}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948060645_948060651 27 Left 948060645 2:235041371-235041393 CCTTCACCGAATCCAGCTCAGCC 0: 1
1: 0
2: 0
3: 9
4: 127
Right 948060651 2:235041421-235041443 GATGAGCTTCCAGTCACAAACGG 0: 1
1: 0
2: 4
3: 8
4: 138
948060645_948060648 -6 Left 948060645 2:235041371-235041393 CCTTCACCGAATCCAGCTCAGCC 0: 1
1: 0
2: 0
3: 9
4: 127
Right 948060648 2:235041388-235041410 TCAGCCACCACGAATAGCACTGG 0: 1
1: 0
2: 0
3: 6
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948060645 Original CRISPR GGCTGAGCTGGATTCGGTGA AGG (reversed) Exonic
900364231 1:2304326-2304348 GGCGGAGCTGGATGAGGTAAAGG - Exonic
901151940 1:7109458-7109480 GGCTGAATTGGATTCAGGGATGG + Intronic
902689946 1:18104846-18104868 GGCTGAGCTGGAGTCCTTGGCGG - Intergenic
906594511 1:47062968-47062990 GGGTGAGGTGGACTCTGTGAGGG - Intergenic
906662451 1:47592847-47592869 TGCTGAGTGGGATTCAGTGAAGG + Intergenic
906710621 1:47927179-47927201 GGCTAAGCTGGTCTTGGTGAAGG + Intronic
910489403 1:87752132-87752154 GACAGAGCTGGATTAGATGATGG - Intergenic
911323293 1:96440256-96440278 GAATGAGGTGGATTCTGTGAGGG + Intergenic
912617805 1:111123379-111123401 ACCTGAGCTGGGTTTGGTGAAGG - Intronic
914857792 1:151365002-151365024 GGCTGAGCTGGATCATCTGAGGG + Exonic
915626607 1:157117802-157117824 GGCTGACCTGCATTCTGGGAAGG + Intergenic
915930120 1:160055066-160055088 GAGTGAGCTGGAGTCGGGGAAGG - Intronic
918671653 1:187224433-187224455 GGCTGAGCTGGTATCTGAGATGG + Intergenic
922554475 1:226522225-226522247 GGCTGAGCTGGGCTGGGTGCAGG - Intergenic
922562391 1:226578695-226578717 GGCTGAGTCTGACTCGGTGAAGG + Intronic
923511411 1:234656923-234656945 GGTTGAGCTGGATTCCGAAAAGG - Intergenic
1065928674 10:30459124-30459146 GGCTGAACTGCATTCGTTGCAGG + Intronic
1067567779 10:47350737-47350759 GGCTGAACTGGAGACAGTGAAGG + Exonic
1073730502 10:106281883-106281905 GGCTGAGGTGGGTTGGGTGTTGG - Intergenic
1074399541 10:113130285-113130307 GGGTGAGCTGGAATCTGGGAAGG + Intronic
1074578427 10:114693150-114693172 GGCTGTGTTGGGATCGGTGAGGG + Intergenic
1076098438 10:127753562-127753584 GGCTGAGCTGGAAGAGGAGAAGG + Intergenic
1076736623 10:132461993-132462015 GGGGGAGCTGGATTGGGTGCCGG - Intergenic
1081704990 11:45177453-45177475 TGCTGAGATGGACTCAGTGAAGG + Intronic
1081721474 11:45292341-45292363 GGCTGGGCAGGATTCTATGATGG - Intergenic
1083304736 11:61756424-61756446 GGCTGAGCTGGGCTTCGTGATGG + Intronic
1083757406 11:64799137-64799159 GGCTGAGCAGGGTAGGGTGAGGG + Intronic
1084434313 11:69129908-69129930 GGCTGGGCTGGGTCCGCTGAAGG - Intergenic
1084732891 11:71084774-71084796 GGCTGAGCTGGATTCACTCCTGG - Intronic
1085920385 11:80948244-80948266 AGCTAAGCTGGCTTCGGGGAGGG - Intergenic
1089040286 11:115442007-115442029 TGCTGAACTGAATTCTGTGAAGG - Intronic
1091139506 11:133223056-133223078 GGCTGAACTGGTTGGGGTGAGGG - Intronic
1091742646 12:2971038-2971060 GGCTGCTGTGGATTGGGTGAGGG - Intronic
1094646257 12:32327619-32327641 GGCTGAGCTGGACGGGGAGAAGG + Exonic
1095961302 12:47835805-47835827 GTCTGAGCTGGACTCTGGGAAGG - Intergenic
1100205361 12:92342801-92342823 TGCTGAGCTGGCCTTGGTGATGG + Intergenic
1101265591 12:103082920-103082942 GGCTAAGCAGGTTTCTGTGAAGG + Intergenic
1101573878 12:105979897-105979919 GGCTGAGATGGATTGGGGCAGGG + Intergenic
1103208009 12:119145493-119145515 GGCTGAGCTGGTTTGCGTGGAGG - Exonic
1104372504 12:128236255-128236277 GTTTGTGCTGGACTCGGTGATGG + Intergenic
1104386420 12:128355226-128355248 GGATGAGCAGGAATAGGTGAAGG + Intronic
1105571955 13:21611209-21611231 ACCTGAGCTGGTTGCGGTGATGG - Intergenic
1110075732 13:71239859-71239881 GGCAGAGGTGGATTGGGAGATGG + Intergenic
1113534917 13:111058489-111058511 GACTGAGGTGGACTCTGTGAGGG + Intergenic
1114569747 14:23658354-23658376 GGCTGAGCTGGGGGCGCTGAAGG - Intergenic
1124028647 15:25989679-25989701 GGCGGAGGTGCAGTCGGTGAAGG - Intergenic
1129879766 15:78998913-78998935 GGCTGAGCTGGGGTGAGTGAGGG + Intronic
1132290364 15:100696655-100696677 GGGTGAGCTGGCTTTGGAGAGGG - Intergenic
1134530000 16:14975431-14975453 GGCTGGGCGGGGTTCGGTGGGGG + Intronic
1134647703 16:15883470-15883492 GGCTGAGCAGGGGTCGGGGAGGG - Intronic
1134710864 16:16326454-16326476 GGCTCAGCGGGATGAGGTGAGGG - Intergenic
1134948737 16:18342191-18342213 GGCTCAGCGGGATGAGGTGAGGG + Intergenic
1136270415 16:29145145-29145167 GGCTGAGCTGGCCATGGTGAGGG - Intergenic
1138431030 16:56969377-56969399 GGCTGATCTGGATGCTGGGAAGG - Exonic
1141016679 16:80457391-80457413 GGCTGAGCTGAATTGGGAGCAGG + Intergenic
1141139248 16:81486717-81486739 GGCACAGCTGGATTCGCTTAGGG - Intronic
1141205210 16:81928095-81928117 GGCAGAGCTGGAAAGGGTGATGG + Intronic
1141907388 16:87036279-87036301 GGCTGAACTGGATTCTCTCAAGG + Intergenic
1142074001 16:88106954-88106976 GGCTGAGCTGGCCATGGTGAGGG - Intronic
1147025204 17:37576382-37576404 GGCTGAGCAGGATCCTGTGAGGG + Exonic
1147183754 17:38702912-38702934 GGCTGGGCTGGATTCGTGGCGGG - Intergenic
1148114143 17:45165028-45165050 GGCTGGGCTCGCTTGGGTGAGGG + Intronic
1148558316 17:48591717-48591739 AGCTGAGCTGGCTTCGGAGATGG - Exonic
1149498965 17:57136760-57136782 GGCTGAGCAGGATTTGGGGGAGG + Intergenic
1151743837 17:76001159-76001181 GGCTGAACTGGGCTGGGTGAAGG + Intronic
1152013440 17:77734842-77734864 GGCTGAGCGGGAGTGGGGGAAGG + Intergenic
1156369433 18:36459437-36459459 GGCTGGGCTGCCTTAGGTGAGGG + Intronic
1161237766 19:3206273-3206295 GGAGCAGCTGGACTCGGTGATGG + Exonic
1162300692 19:9843210-9843232 GGCTGACCTGGATGCTGGGATGG - Intronic
1163294556 19:16404010-16404032 GGCTTAGCTTGTTTCGGGGATGG - Intronic
1166280920 19:41792672-41792694 TGCTGAGCTGGATAGCGTGAGGG - Intergenic
926081187 2:9987709-9987731 GGCTGAGCTGGATTCAATGCAGG + Intronic
926537326 2:14129226-14129248 GGCTTAGCTGGGTTCTGTGGTGG + Intergenic
930105075 2:47633054-47633076 GGCTGGGCTGGGCTGGGTGAGGG - Intergenic
935277174 2:101485065-101485087 GGCTGAGCTGCAGACGGGGAGGG - Intergenic
935617656 2:105102616-105102638 GGCTGAGGTGGATTTGTGGAGGG + Intergenic
936141935 2:109948146-109948168 GGCTGAGCAGGGATCGGTGCTGG + Intergenic
936178623 2:110246094-110246116 GGCTGAGCAGGGATCGGTGCTGG + Intergenic
936202755 2:110423338-110423360 GGCTGAGCAGGGATCGGTGCTGG - Intronic
937062928 2:118993522-118993544 GGCTGGCCTGGCTTCGGTCAAGG + Intronic
942596185 2:177593830-177593852 GGCTTCGCTGGATTTGGTGGTGG - Intergenic
947335896 2:229082767-229082789 GGCTGAGCTGTATTCTCTTATGG - Intronic
947926581 2:233926984-233927006 GGGTGAGCTGGAGTCGGGGTTGG + Intronic
948060645 2:235041371-235041393 GGCTGAGCTGGATTCGGTGAAGG - Exonic
948449569 2:238060859-238060881 GGCTGCGCTGGGTCAGGTGACGG - Intronic
1174213555 20:48898987-48899009 GGCAGAGGTGGATGAGGTGAAGG - Intergenic
1178665555 21:34543328-34543350 GGCAGGGCTGGAGTCGGAGATGG + Intronic
1180118146 21:45725719-45725741 GGCTGAGCAGGAGTGGCTGAGGG + Intronic
1181791554 22:25271157-25271179 GGCTGAGCTGGATGCAGAAAGGG + Intergenic
1181827246 22:25527264-25527286 GGCTGAGCTGGATGCAGAAAGGG + Intergenic
1184442773 22:44528449-44528471 GGCTGAGATGGAATGGGTTAAGG + Intergenic
1185142747 22:49112545-49112567 GGCTGAGCTGGAGTCTTTGATGG + Intergenic
1185249684 22:49794124-49794146 GGCTCAGCTTGTTTCGGAGAAGG + Exonic
952965914 3:38621108-38621130 GGCAGAGCTGGAGTTGGGGATGG + Intronic
953926693 3:46986174-46986196 GGCTGAGCTGGGTTCAGGGCTGG - Intronic
954025686 3:47781629-47781651 GTCCCAGCTGGATTCGGTGCGGG - Exonic
954278321 3:49557029-49557051 AGCTGAGTTGGACTCTGTGAGGG + Intronic
964371361 3:156003930-156003952 GGCTGAGCTTGGTGCGGGGAGGG - Intergenic
966948063 3:184791397-184791419 GGCTGTGCTGGAGTGGGGGAGGG - Intergenic
970245853 4:14062064-14062086 GTTTGAGCTGGATTCTGTGATGG + Intergenic
970312105 4:14793382-14793404 GGGTGAAATGGATTCTGTGAGGG - Intergenic
975111595 4:70634521-70634543 GGCTGAGGTTGATTATGTGATGG - Exonic
979863644 4:125725377-125725399 GGCAGAGGTGGATGAGGTGAAGG + Intergenic
982069844 4:151685601-151685623 GGCTCAACAGGATTTGGTGAGGG - Intronic
985591374 5:767085-767107 GGTTGGGCTGGAGTCGGTGCAGG + Intergenic
985604428 5:850768-850790 GGCTGGGCTGGAGTCGGTGCAGG + Exonic
986644894 5:9907262-9907284 AGCTGAGCTGGATTCAGGAAGGG - Intergenic
988451093 5:31343809-31343831 GGCTGGGCTGGATGATGTGACGG + Intergenic
989035044 5:37162096-37162118 GACTGGACTGGGTTCGGTGAGGG - Intronic
992896874 5:81253247-81253269 GGCTGAGCTTTATTGGGTGGGGG + Intronic
1006379230 6:33688041-33688063 GGCTGAGCTGGAGGTGGGGAGGG - Exonic
1006382235 6:33706213-33706235 GGTAGAGCTGGATTCGGTCCAGG + Intronic
1007049719 6:38814924-38814946 GGCTGAGCTGCATTCTGCGATGG + Intronic
1018009455 6:159656020-159656042 GGCTGAAATGGACTCTGTGAGGG - Intergenic
1023055687 7:36288063-36288085 GGATGAGCTGTCTTCGGGGAAGG - Intronic
1024532513 7:50405605-50405627 GGCAAGGCTGGAGTCGGTGAGGG - Intergenic
1024745315 7:52399698-52399720 GGCTGAAATGGACTCTGTGAGGG + Intergenic
1028831010 7:95326587-95326609 GGCTCAACTGGAGTGGGTGAAGG + Intergenic
1031120263 7:117714054-117714076 GGCTGAGCTACATCTGGTGAGGG + Intronic
1032460257 7:132104924-132104946 GACTGAGCTGGCGTTGGTGAGGG - Intergenic
1034426753 7:151018069-151018091 GGCTGAGCAGGGGTCGCTGAGGG + Intronic
1038410261 8:27353026-27353048 GCCTGGGCTGGCTTAGGTGAAGG - Intronic
1039885832 8:41653655-41653677 GGCTGGGACCGATTCGGTGACGG - Intronic
1041092430 8:54315646-54315668 GGCTGAGCTGGGCTCGGTGCCGG + Intergenic
1049548790 8:143246875-143246897 GCCTGGGCCGGACTCGGTGATGG - Intergenic
1053141692 9:35686503-35686525 CACTGAGCTTGATTCTGTGACGG - Intronic
1056300465 9:85234848-85234870 GGGTGAGCAGGATTTGGAGATGG - Intergenic
1057792878 9:98135489-98135511 GGCTGGGCTGGATGGGGTCATGG + Intronic
1058598909 9:106647587-106647609 GGCCTAGGTGGATTAGGTGAAGG - Intergenic
1059483913 9:114612482-114612504 GGCTGAGCTGGATGGGGAAATGG + Intronic
1061365801 9:130172123-130172145 GCCAGGGCTGGATTCGGGGAGGG + Intergenic
1061597152 9:131638634-131638656 GGCTGTGCTGGATGGAGTGAAGG - Exonic
1062159185 9:135070284-135070306 GGCTCAGCTGGATTTGGAGAGGG + Intergenic
1195231926 X:102859157-102859179 GGCTAAAATGGATTCTGTGAGGG + Intergenic
1197664564 X:129210152-129210174 GGGTGAAATGGATTCTGTGATGG + Intergenic
1198176471 X:134160612-134160634 GGCTTAGCTAGATTTGATGATGG - Intergenic
1199480347 X:148291571-148291593 GGCTAAGCAGGACTTGGTGATGG - Intergenic