ID: 948060959

View in Genome Browser
Species Human (GRCh38)
Location 2:235043036-235043058
Sequence CATGAGCAGGGTCCTCACGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 100}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948060959_948060964 -5 Left 948060959 2:235043036-235043058 CCTCCGTGAGGACCCTGCTCATG 0: 1
1: 0
2: 0
3: 8
4: 100
Right 948060964 2:235043054-235043076 TCATGGAGAACATCAGCAGCTGG 0: 1
1: 0
2: 1
3: 20
4: 178
948060959_948060965 17 Left 948060959 2:235043036-235043058 CCTCCGTGAGGACCCTGCTCATG 0: 1
1: 0
2: 0
3: 8
4: 100
Right 948060965 2:235043076-235043098 GCGCTCCTTCGCTGACGCCCTGG 0: 1
1: 0
2: 0
3: 4
4: 53
948060959_948060966 18 Left 948060959 2:235043036-235043058 CCTCCGTGAGGACCCTGCTCATG 0: 1
1: 0
2: 0
3: 8
4: 100
Right 948060966 2:235043077-235043099 CGCTCCTTCGCTGACGCCCTGGG 0: 1
1: 0
2: 0
3: 3
4: 53

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948060959 Original CRISPR CATGAGCAGGGTCCTCACGG AGG (reversed) Exonic
900940093 1:5793121-5793143 CATGAGCAGGGTCTTCCCACAGG + Intergenic
907476183 1:54707187-54707209 CATCAGAAGGGTCCTGTCGGGGG - Intronic
907743974 1:57194072-57194094 CAAGAGCAGGGCCCACAGGGAGG + Intronic
917749302 1:178039857-178039879 CAAGAGCAAGGTCCTCACCTTGG + Intergenic
924638308 1:245809508-245809530 CAACAGCAGGGTTCTCAGGGAGG - Intronic
1064353237 10:14596003-14596025 CATGAGCCACGTCCTCACCGTGG + Intronic
1074221700 10:111444517-111444539 CATGAGCAGTGTCCTCTGGAAGG + Intergenic
1077170051 11:1162091-1162113 GCTGAGCAGGGTCCTCATGAAGG + Exonic
1080913375 11:36628289-36628311 CATGAGCAAAGCCCTCAAGGTGG - Intronic
1085031377 11:73272899-73272921 CTGGAGAGGGGTCCTCACGGAGG + Intronic
1094160216 12:27382239-27382261 CATTAGCAGTGTCCTAAGGGAGG + Intronic
1107022496 13:35766037-35766059 CATGACCAGGGTCGTGAAGGAGG - Intergenic
1112494669 13:99895561-99895583 CCTGAGCGCGGTCCCCACGGAGG + Exonic
1114496523 14:23136843-23136865 CAGGAGCAGTGGCCACACGGAGG - Intronic
1122324684 14:100875204-100875226 CCTGAGCAGGGTACGCACAGGGG - Intergenic
1122624750 14:103078832-103078854 CTTGAACAGGCTGCTCACGGTGG - Intergenic
1122769742 14:104092660-104092682 CATGGGCAGTGTCCTCAGGATGG - Exonic
1128791906 15:70440108-70440130 CTTGAGCTGGGTCCCCACTGGGG - Intergenic
1132695156 16:1198789-1198811 TCTGGGCAGGGGCCTCACGGGGG - Intronic
1133228942 16:4357227-4357249 GACGAGCAGGGGCCTCTCGGGGG + Exonic
1133308253 16:4825216-4825238 CATGAGCATGGTCTACAGGGAGG + Intronic
1138539392 16:57679307-57679329 CCTGAGCAGGGGACTCACAGGGG - Exonic
1141612683 16:85191899-85191921 CATTAGCAGGGTCTCCAGGGTGG + Intergenic
1141618800 16:85225506-85225528 CGTGAGAAGGGTCCCCAGGGAGG + Intergenic
1142777159 17:2149877-2149899 CATGAGCAGGACCCTCCCGGTGG - Intronic
1144703007 17:17350937-17350959 CCTCAGCAGGGTCCCCAGGGTGG - Intergenic
1150601573 17:66655367-66655389 CATGAGCAGCTTCCCCACTGTGG + Intronic
1150613464 17:66751654-66751676 GATGAGCAGGGTCCTATAGGTGG + Intronic
1152624175 17:81380673-81380695 CATGAGCACGTTCGTCATGGAGG + Intergenic
1157611574 18:48959965-48959987 CAAGAACAAAGTCCTCACGGTGG + Intergenic
1158344107 18:56497590-56497612 CATGAGCAGGAGTTTCACGGAGG - Intergenic
1159494023 18:69177170-69177192 CAGGAACAGGGTCCTCACTGGGG + Intergenic
1159798038 18:72867603-72867625 CGGGAGGAGGGTCCTGACGGCGG - Exonic
1162924557 19:13923669-13923691 CATGAGCAGGGCCCTCCCACCGG + Intronic
1166103905 19:40588325-40588347 CAGGAGCAGGGACCTCTGGGAGG + Intronic
1166318170 19:42000281-42000303 CAAGAGCAGGGAGCTCATGGAGG + Intronic
1166835670 19:45666343-45666365 CATGTGCAGGTTTGTCACGGGGG - Intergenic
1166980235 19:46627730-46627752 CCACAGCAGGGTCCACACGGGGG + Intergenic
1168319130 19:55498652-55498674 CAGGTGCAGGGTCCTCATGCTGG + Intronic
925749313 2:7073198-7073220 CATGAGCTGGGTCTTGAAGGAGG - Intergenic
927154243 2:20212567-20212589 CAGGAGGAGGGGCCTCACTGGGG + Intronic
932282848 2:70509665-70509687 CATGAGCTGGGTACTCAGGGCGG - Intronic
936250231 2:110862739-110862761 CAGGAGGAGGGTCCTCACTGGGG - Intronic
937309789 2:120895031-120895053 CATCAGCCAGGTCCTCAAGGAGG - Intronic
939200145 2:139023388-139023410 CATGAGCAAAGTCATCAGGGTGG + Intergenic
942724740 2:178994215-178994237 CAGGGGCAGGGCCCTCATGGAGG - Intronic
946438358 2:219674593-219674615 CTTGGGAAGGGTCCTCACTGAGG - Intergenic
947536827 2:230945003-230945025 CAGGAGCAGGAGCCTCACTGCGG + Intronic
948060959 2:235043036-235043058 CATGAGCAGGGTCCTCACGGAGG - Exonic
948657834 2:239487500-239487522 CATGAGCAGGGGGCTCCCCGAGG - Intergenic
1169889367 20:10435635-10435657 CATGAGCATGGGCATTACGGTGG + Intronic
1171096608 20:22338056-22338078 CCAGAGCAGGGTCATCACAGAGG + Intergenic
1175550679 20:59815170-59815192 CATGAGGAGGGACCTCATCGGGG + Intronic
1175801176 20:61801811-61801833 CATGTGAAGGGTCCTTATGGAGG - Intronic
1176247989 20:64106367-64106389 CATGTGGCGGGACCTCACGGTGG + Exonic
1178344578 21:31813987-31814009 CATGAGGATGGTCCTTACAGTGG + Intergenic
1178718583 21:34988772-34988794 CATGTGCAGGGTGCTCACTCAGG - Intronic
1179819935 21:43930772-43930794 CAGGAGGTGGCTCCTCACGGTGG + Intronic
1179878551 21:44283937-44283959 CATGGGCAGGGGTCTCACGAAGG - Intergenic
1181407170 22:22693255-22693277 CATGTGCAGTGTCCTCCCTGAGG + Intergenic
1181415157 22:22754020-22754042 CATGTGCAGTGTCCTCTCTGAGG + Intronic
1182238318 22:28894518-28894540 CATGCTCAGAGGCCTCACGGTGG + Intronic
1182649813 22:31842286-31842308 CATGAGCAGGCTGAGCACGGTGG + Intronic
1183480296 22:38060493-38060515 CCTGAGCAAGATCCTCACAGAGG - Intronic
951048587 3:18068557-18068579 GATGAGCAGGTTCCTCAAGCTGG + Intronic
951281207 3:20751957-20751979 CATGAGCAGGGTTCTCAAAAAGG - Intergenic
952831393 3:37568064-37568086 CAGGAGTGGGGCCCTCACGGGGG - Intronic
954807067 3:53226774-53226796 CAAGGGCAGGATCCTCACCGTGG - Exonic
962308830 3:134311859-134311881 AATGAATAGGGTCCTCACTGGGG + Intergenic
962410252 3:135135053-135135075 CATGAGAAGTGTGCTCATGGAGG - Intronic
967880551 3:194298477-194298499 CAGGAGCAGGGGGCGCACGGAGG - Intergenic
968816121 4:2822858-2822880 CCTGTGGAGGGTCCTCACAGTGG + Intronic
970384607 4:15543658-15543680 CAGGGGCAGGGACCTCACAGGGG - Intronic
978092568 4:104736296-104736318 TAATAGCAGGGTCCTCACTGTGG - Intergenic
985290039 4:188377508-188377530 CATAAGCATGGTCCTCAAGGGGG + Intergenic
986903719 5:12468170-12468192 CAGGAGCAGGGTACTGATGGGGG - Intergenic
989196988 5:38725595-38725617 TCTGAGCAGGGACCTCCCGGCGG - Intergenic
1000155335 5:158545578-158545600 CATGAGCAGGCTGGGCACGGTGG - Intergenic
1004158769 6:13194901-13194923 TCTGAGGACGGTCCTCACGGAGG + Intronic
1006151360 6:31991920-31991942 CATGAGCTGGGGAGTCACGGAGG + Intronic
1006157661 6:32024658-32024680 CATGAGCTGGGGAGTCACGGAGG + Intronic
1008252608 6:49258669-49258691 CATTTGCAGGCTCCTCAAGGAGG - Intergenic
1008879809 6:56370471-56370493 CATGTGCAGTGCCCTCACAGAGG - Intronic
1015450010 6:133356135-133356157 GAGGAGCAGGGTCATCACGATGG - Intronic
1017132044 6:151115680-151115702 CATGAGCAGTGTCTATACGGAGG - Intergenic
1017893992 6:158663499-158663521 CCTGAGAAGGGTCCTAACGAAGG + Intronic
1017955651 6:159175665-159175687 TGTGAGCAGGGTCCTCACTGTGG + Intronic
1019147023 6:169982154-169982176 CCTGAGCATGGACCCCACGGGGG - Intergenic
1020251990 7:6476676-6476698 TATGAGCTGGGTCCCCACGGGGG - Intronic
1021814926 7:24437708-24437730 TACGAGCAGGGTCCTCCAGGGGG - Intergenic
1032130109 7:129220978-129221000 CATGAGTATGGTCTTCAGGGCGG + Intergenic
1032455047 7:132066829-132066851 CGGGAGCAGGGTCCTGGCGGGGG + Intergenic
1035469378 7:159099958-159099980 CTTGAGGAAGGTCCTCAGGGAGG - Intronic
1037672415 8:21026626-21026648 CATGAGCAGGGCCATGAAGGTGG - Intergenic
1041981496 8:63866401-63866423 CATGGGCAGGGGCATCAAGGAGG + Intergenic
1043974556 8:86570185-86570207 CATGAGCAAGCTCCCCAAGGTGG - Intronic
1046166213 8:110439759-110439781 CATCAGCAGGATCCTCACATTGG - Intergenic
1047300447 8:123609411-123609433 AATAAGCAGGGTCCTCAGGGAGG + Intergenic
1049545902 8:143230398-143230420 CAGCAGCAGAGACCTCACGGGGG + Intergenic
1055019460 9:71653523-71653545 CAGGAACAGGGGCCTCACAGAGG - Intergenic
1059469625 9:114494953-114494975 GAAGAGCAGGCTCCTCAGGGTGG + Intronic
1060233255 9:121841157-121841179 CATGAGCAGAGGCCCCACGATGG + Intronic
1062393555 9:136343466-136343488 CCTGAGCAGGGCCCAGACGGTGG - Intronic
1062501295 9:136853096-136853118 CAGCAGCAGGGTCCTCAGGCTGG + Exonic
1192845404 X:74902131-74902153 GATGACCAGGGTCCTCAGGTTGG - Intronic
1197341038 X:125266611-125266633 CAGGAGTAGGGACCTCATGGAGG + Intergenic
1198872832 X:141193966-141193988 CAGGGGCAGGGCCCTCATGGAGG + Intergenic
1199329539 X:146542868-146542890 CAGGGGCAGGGCCCTCACAGAGG - Intergenic
1202201502 Y:22355774-22355796 TATGAGCAGGCACCTCACAGAGG - Intronic