ID: 948060961

View in Genome Browser
Species Human (GRCh38)
Location 2:235043039-235043061
Sequence CTCCATGAGCAGGGTCCTCA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 661
Summary {0: 1, 1: 0, 2: 7, 3: 61, 4: 592}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948060961_948060965 14 Left 948060961 2:235043039-235043061 CCGTGAGGACCCTGCTCATGGAG 0: 1
1: 0
2: 7
3: 61
4: 592
Right 948060965 2:235043076-235043098 GCGCTCCTTCGCTGACGCCCTGG 0: 1
1: 0
2: 0
3: 4
4: 53
948060961_948060964 -8 Left 948060961 2:235043039-235043061 CCGTGAGGACCCTGCTCATGGAG 0: 1
1: 0
2: 7
3: 61
4: 592
Right 948060964 2:235043054-235043076 TCATGGAGAACATCAGCAGCTGG 0: 1
1: 0
2: 1
3: 20
4: 178
948060961_948060966 15 Left 948060961 2:235043039-235043061 CCGTGAGGACCCTGCTCATGGAG 0: 1
1: 0
2: 7
3: 61
4: 592
Right 948060966 2:235043077-235043099 CGCTCCTTCGCTGACGCCCTGGG 0: 1
1: 0
2: 0
3: 3
4: 53

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948060961 Original CRISPR CTCCATGAGCAGGGTCCTCA CGG (reversed) Exonic
900117475 1:1034746-1034768 CTCTATGTGCAGGGGCCTCGGGG - Intronic
900408277 1:2501927-2501949 CTTCAGGAGCAGGGTCCCTAGGG - Intronic
901955102 1:12778347-12778369 CTGTATGAGCAGGAGCCTCAGGG + Intergenic
901972819 1:12921185-12921207 CTGTATGAGCAGGAGCCTCAGGG + Intronic
902012361 1:13280577-13280599 CTGTATGAGCAGGAGCCTCAGGG - Intergenic
903650184 1:24917251-24917273 CTCCAGGGGCAGGGTCAGCATGG - Intronic
903702968 1:25264282-25264304 CTGCAGGAGCAGGGCCCTCATGG - Intronic
903712234 1:25334608-25334630 CTGCAGGGGCAGGGCCCTCATGG - Intronic
903968003 1:27101860-27101882 CTCCATGAGCAGAGCCTTCCGGG - Intronic
907245895 1:53108996-53109018 CACCAGGAGCACGGACCTCATGG - Intronic
907925678 1:58953367-58953389 CTGCAGGGGCAGGGTACTCATGG + Intergenic
908100883 1:60789871-60789893 CTCTATTAGCAGGGCCATCAAGG - Intergenic
908627224 1:66058491-66058513 CTGCAGGAGCAGGGCCCTCATGG - Intronic
908967839 1:69787447-69787469 CTGCAGGGGCAGGGCCCTCATGG - Intronic
909054230 1:70803925-70803947 CTGCAGGGGCAGGGTGCTCATGG + Intergenic
909274425 1:73666315-73666337 CTGCAGGGGCAGGGTCCTCATGG + Intergenic
910691402 1:89969065-89969087 ATCCAAGAGCATGGTCCCCAAGG + Intergenic
910715548 1:90225683-90225705 CTGCAGGAGCAGAGCCCTCATGG + Intergenic
911738496 1:101362671-101362693 CTGCAGGGGCAGGGCCCTCATGG + Intergenic
911848424 1:102783834-102783856 CTGCAGGAGCAGAGCCCTCATGG - Intergenic
912135471 1:106655998-106656020 CTGTAGGAGCGGGGTCCTCATGG - Intergenic
912405502 1:109434310-109434332 CTGCAGGAGCAGGGCCCTCATGG - Intergenic
913336944 1:117717326-117717348 CTGCAGGGGCAGGGCCCTCATGG + Intergenic
913396348 1:118376445-118376467 CTGCAGGAGCAGGGCTCTCATGG - Intergenic
915290510 1:154879981-154880003 CTCCATGAGCAGCCTCTCCAGGG + Intergenic
915710928 1:157897183-157897205 CTGCAGGGGCAGGGCCCTCATGG - Intronic
915786976 1:158624136-158624158 CTGCAGGGGCAGAGTCCTCATGG + Intronic
916734788 1:167598125-167598147 CTGCAGGGGCAGGGCCCTCATGG - Intergenic
916959238 1:169872427-169872449 CTGCATGGGCAGGGCCCTTATGG + Intronic
917022222 1:170601790-170601812 CTGCAGGAGCAGGTTCCTCATGG - Intergenic
917043685 1:170833685-170833707 CTGCAGGGGCAGTGTCCTCATGG + Intergenic
917133424 1:171764631-171764653 CTCCCTCAGGAGGGTCCTGAAGG + Intergenic
917152118 1:171956726-171956748 CTGCAGGGGCAGGGCCCTCATGG - Intronic
917892459 1:179453163-179453185 CTGCAGGGGCAGGGCCCTCATGG + Intronic
918119893 1:181529342-181529364 CTGCAGGGGCAGGGCCCTCATGG + Intronic
918188580 1:182149481-182149503 CTCCATGAGAAAGCTCGTCAAGG + Intergenic
918800182 1:188961116-188961138 CTGCAGGGGCAGGGCCCTCATGG + Intergenic
919209072 1:194455826-194455848 CTGCAGGGGTAGGGTCCTCATGG - Intergenic
919277468 1:195439641-195439663 CTGCATGGGCAGAGCCCTCATGG - Intergenic
919394091 1:197023069-197023091 CTGCAGGAGCAGAGCCCTCATGG + Intergenic
919409683 1:197227804-197227826 CTGCAGGAGCGGGGCCCTCATGG - Intergenic
919536732 1:198796913-198796935 CTGCATGAGCAGAGCCCTCATGG - Intergenic
919735820 1:200949804-200949826 CTCCATCATCAGGTTCCTCCAGG + Intergenic
921000597 1:211039326-211039348 CTACAGGGGCAGGGCCCTCATGG + Intronic
921594334 1:217038237-217038259 CTGCAGGGGCAGGGCCCTCACGG - Intronic
921716035 1:218417965-218417987 CTGTAGGGGCAGGGTCCTCATGG + Intronic
921773570 1:219071666-219071688 CTGCAGGGGCAGGGCCCTCATGG + Intergenic
922530481 1:226341407-226341429 CTGCAGGGGCAGGGTGCTCATGG + Intergenic
923234357 1:232018379-232018401 TTCCATGACCAGGGTCTCCAAGG - Intronic
924394774 1:243607072-243607094 CTGCAGGGGCAGAGTCCTCATGG + Intronic
924784200 1:247180290-247180312 CTCCATGAACAGGGTGATGAGGG + Intergenic
1064094830 10:12416592-12416614 CACCATGAGCAGCTTCCCCAGGG - Intronic
1067814714 10:49464879-49464901 CTGCAGGGGCAGGGTTCTCATGG + Intronic
1068354809 10:55897364-55897386 CTGCAGGGGCAGGGGCCTCAGGG - Intergenic
1068519460 10:58062765-58062787 CTGCAGGAGCAGGGCCCTCATGG - Intergenic
1069310023 10:67023330-67023352 CTCCATGAAAAGTTTCCTCATGG + Intronic
1071018938 10:81029543-81029565 CTATAGGGGCAGGGTCCTCATGG - Intergenic
1071745843 10:88418659-88418681 CTCTATTAGCAGAGTTCTCATGG + Intronic
1072475493 10:95756146-95756168 CTCCGTGAGAGAGGTCCTCAAGG - Intronic
1073942399 10:108713639-108713661 CTGCAGGAGCAGGGCCCTCATGG + Intergenic
1073954111 10:108848160-108848182 CTCCAAGGGTGGGGTCCTCATGG + Intergenic
1073994017 10:109295135-109295157 CTGCAGGGGCAGGGTTCTCATGG + Intergenic
1075489435 10:122853850-122853872 CCCCATGGGGAGGGTCCACAGGG - Intronic
1075550363 10:123388355-123388377 CTGCAGGGGCAGGGCCCTCATGG + Intergenic
1075943453 10:126410987-126411009 CTCCATGATCAGGGTGCTAATGG + Intergenic
1077827478 11:5826612-5826634 CTGCATGGGTGGGGTCCTCATGG + Intronic
1077985024 11:7342798-7342820 CTGCAGGGGCAGGGCCCTCATGG - Intronic
1079656097 11:22988123-22988145 CTACAGGGGCAGGGCCCTCATGG - Intergenic
1079736190 11:23999785-23999807 CTGCAGGGGCAGGGCCCTCATGG - Intergenic
1080855275 11:36106553-36106575 CCCCAGGAGGAGGGTCCTAAGGG + Intronic
1080913377 11:36628292-36628314 TTCCATGAGCAAAGCCCTCAAGG - Intronic
1081157797 11:39716277-39716299 CTGCAGGGGCAGGGCCCTCATGG + Intergenic
1081241839 11:40716230-40716252 GTCCATGTGCAAGGTCCTTAGGG + Intronic
1081315562 11:41625459-41625481 CTGCAGGGGCAGAGTCCTCATGG - Intergenic
1081437271 11:43040898-43040920 CTGCAGGGGCAGGGCCCTCACGG - Intergenic
1084179264 11:67438439-67438461 CTCCTTGACCAGCGCCCTCAGGG + Exonic
1084306600 11:68288839-68288861 CTCCATGTCCAGTGTCCTCCAGG + Intergenic
1084704478 11:70807875-70807897 CTCACTGAGCAGTGTCCCCAAGG - Intronic
1085054270 11:73394819-73394841 CCCATTGAGCAGGGTGCTCAGGG - Intronic
1085555311 11:77414100-77414122 CTCCAGGAGCAACGTCCTCCAGG + Intronic
1085593946 11:77791097-77791119 CTGCAGGGGCAGGGTCCTCATGG - Intronic
1087035799 11:93755272-93755294 CTCCATCTGCAGGGTTCACATGG - Exonic
1087474634 11:98620517-98620539 CTGCAGGAGCAGGGCCCTTATGG + Intergenic
1088175833 11:107051787-107051809 CTGCAGGGGCAGGGCCCTCATGG + Intergenic
1090504653 11:127298206-127298228 CTGCAGGGGCAGGGCCCTCATGG + Intergenic
1092139354 12:6172052-6172074 CTCCATGAGCAAGTCCCTGAGGG + Intergenic
1092184397 12:6468003-6468025 CTGCAAGGGCAGGGCCCTCATGG + Intronic
1093353124 12:18128303-18128325 CTGTAGGGGCAGGGTCCTCATGG + Intronic
1095122613 12:38437214-38437236 CTGCAAGGGCAGGGCCCTCATGG - Intergenic
1095131568 12:38548965-38548987 CTGCAGGGGCAGGGCCCTCATGG - Intergenic
1095382826 12:41615666-41615688 CTACACGGGCAGGGCCCTCATGG + Intergenic
1097360470 12:58654019-58654041 CTGCAGGGGCAGGGCCCTCATGG - Intronic
1097400702 12:59124708-59124730 CTGCAGGAGCATGGCCCTCATGG - Intergenic
1097404818 12:59176845-59176867 CTGCAGGAGCGGGGCCCTCATGG - Intergenic
1097668819 12:62512782-62512804 CTGTAGGAGCAGGGTCTTCATGG - Intronic
1098163878 12:67673434-67673456 CTGCAGGGGCAGGGCCCTCATGG - Intergenic
1099088642 12:78278396-78278418 CTGCAGGGGCAGGGACCTCATGG + Intergenic
1099672888 12:85717596-85717618 CTGCAGGGGCAGGGTGCTCATGG - Intergenic
1100474577 12:94923678-94923700 GACCATGAGCAGAGTCCTCGTGG - Intronic
1100933670 12:99639058-99639080 CTCTAGGGGCAGAGTCCTCATGG + Intronic
1101083776 12:101214829-101214851 CTGCAGGGGCAGGGCCCTCATGG + Intergenic
1101232747 12:102757750-102757772 CTCCATGAGAAGGGACCCCAGGG + Intergenic
1101777330 12:107806492-107806514 CTCCCTGAGCAGGGACCCCAAGG + Intergenic
1102248870 12:111372249-111372271 CTGCAGGGGCAGGGCCCTCATGG - Intergenic
1102908868 12:116697412-116697434 CACCTGGAGCAGGGACCTCATGG - Intergenic
1103900302 12:124300388-124300410 CTCCAAGAGCTGGGCCCCCAGGG - Intronic
1104543097 12:129685540-129685562 CTACAGGGGCAGGGCCCTCATGG + Intronic
1104587974 12:130062759-130062781 CTTCATGGGCAGGGACCTCATGG + Intergenic
1104759253 12:131287187-131287209 GTCCAGGAGCAGGGTCCTCACGG - Intergenic
1104821358 12:131679309-131679331 GTCCAGGAGCAGGGTCCTCACGG + Intergenic
1104998909 12:132675972-132675994 CTCCATGAGCTTTGTTCTCAGGG - Intronic
1105235960 13:18553919-18553941 CTGCAGGGGCAGAGTCCTCATGG + Intergenic
1106262294 13:28078256-28078278 CTGCAGGGGCAGGGTCCTCATGG - Intronic
1106571298 13:30930368-30930390 GTGCCTGAGCTGGGTCCTCAAGG - Intergenic
1107039432 13:35933446-35933468 CTGCAGGAGCAGGGCTCTCATGG - Intronic
1107811145 13:44200856-44200878 GTTCATGATCAGGCTCCTCATGG + Intergenic
1108155879 13:47584234-47584256 CTGCAGGGGCAGGGCCCTCATGG - Intergenic
1108419492 13:50233997-50234019 CTGCAGGGGCAGGGTCCTCGTGG + Intronic
1108756460 13:53509106-53509128 CTCCATGATGAGGGCCCACATGG + Intergenic
1108872608 13:55005330-55005352 CTGCAGGGGCAGGGCCCTCATGG - Intergenic
1108933985 13:55864567-55864589 CTGCAGGGGCAGGGCCCTCATGG + Intergenic
1109324646 13:60852789-60852811 CTGCAGGGGCAGGGCCCTCATGG - Intergenic
1109476155 13:62882488-62882510 CTGCAGGGGCAGGGCCCTCATGG - Intergenic
1109871830 13:68342697-68342719 CTGCAGGGGCAGGGTGCTCATGG - Intergenic
1110056919 13:70985449-70985471 CTCCATGGGCAGGGACCTCATGG - Intergenic
1110492397 13:76124699-76124721 CTCCAGGGGCAGGGCCCTCATGG + Intergenic
1111013664 13:82347689-82347711 CGCCATGAGCAGAGACCACATGG + Intergenic
1111045914 13:82812879-82812901 CTGCAGGGGCAGGGCCCTCATGG + Intergenic
1111067028 13:83107249-83107271 CTGCAGGGGCAGGGCCCTCATGG + Intergenic
1111083508 13:83343071-83343093 CTGCAGGAGCAGGGCACTCATGG + Intergenic
1111143843 13:84156017-84156039 CTGCAGGGGCAGGGCCCTCATGG + Intergenic
1111163164 13:84421467-84421489 CTGCAGGAGCAGAGCCCTCATGG + Intergenic
1111207815 13:85035381-85035403 CTGCAGGGGCAGGGCCCTCATGG + Intergenic
1111219095 13:85180815-85180837 CTGCAGGGGCAGGGTCCTCATGG + Intergenic
1111227099 13:85288554-85288576 CTGCAGGAGCAGAGCCCTCATGG - Intergenic
1111313242 13:86517231-86517253 CTGCAGGGGCAGGGCCCTCATGG - Intergenic
1111615076 13:90652482-90652504 CTGCAGGAGCAGGGCCCTCATGG + Intergenic
1111799063 13:92960124-92960146 CTGCAGGGGCAGGGCCCTCATGG - Intergenic
1112919068 13:104587830-104587852 GTCGATGTGCAGGGTGCTCATGG + Intergenic
1113640492 13:111953706-111953728 CTCCAGGGACAGGGTCCTCATGG + Intergenic
1114563411 14:23609861-23609883 CTGCAGGGGCAGGGCCCTCATGG + Intergenic
1114954881 14:27805324-27805346 CTGCAGGGGCAGGGTACTCATGG + Intergenic
1115021293 14:28684271-28684293 CTGCAGGGGCAGGGCCCTCATGG + Intergenic
1115132706 14:30072920-30072942 CTGCAAGGGCAGGGCCCTCATGG + Intronic
1116195151 14:41715895-41715917 CTGCAGGGGCAGGGCCCTCATGG - Intronic
1116420098 14:44722492-44722514 CTGCAGGGGCAGGGTCCTTATGG + Intergenic
1116515543 14:45800668-45800690 CTCTTTAAGCAGGGGCCTCAGGG - Intergenic
1116528337 14:45934946-45934968 CTGCAGCAGCAGGGCCCTCATGG + Intergenic
1116559484 14:46359890-46359912 CTGCAGGGGCAGGGCCCTCATGG - Intergenic
1116986236 14:51222978-51223000 CTGCAGGGGCAGGGCCCTCAGGG - Intergenic
1117186299 14:53243979-53244001 CTGCAGGGGCAGGGCCCTCATGG + Intergenic
1117751656 14:58930091-58930113 CTGCAGGGGCAGGGTGCTCATGG - Intergenic
1118069618 14:62231922-62231944 CTGTAGGGGCAGGGTCCTCATGG + Intergenic
1118326542 14:64785404-64785426 TTCCATGAGCGGGGACCTCTGGG - Intronic
1118460098 14:65979679-65979701 CTGCAGGGGCAGGGCCCTCATGG + Intronic
1118486086 14:66215610-66215632 CTGCAGGGGCAGGGCCCTCATGG - Intergenic
1118657485 14:67967931-67967953 CTGCAGGAGCAGGGCCCTCACGG - Intronic
1118835951 14:69478013-69478035 CTGCAGGGGCAGGGTTCTCATGG - Intergenic
1119101081 14:71880729-71880751 CTGCAAGGGCAGGGCCCTCATGG + Intergenic
1119955943 14:78798672-78798694 CTCCAGGGGCAGAGCCCTCATGG - Intronic
1120759591 14:88273713-88273735 CTCCATGATCAAGGCCCTAAAGG + Intronic
1121611538 14:95284293-95284315 CTGCAGGGGCAGGGCCCTCATGG + Intronic
1121911307 14:97794842-97794864 CACCATGGACAAGGTCCTCACGG - Intergenic
1122379936 14:101295607-101295629 CTGCAAGGGCAGGGCCCTCATGG - Intergenic
1122853048 14:104547070-104547092 CTCCAGATGCAGGGTCCTCATGG + Intronic
1123158862 14:106257946-106257968 CTACATGAGCGGGGTCCGCCAGG - Intergenic
1123193405 14:106592851-106592873 CTACATGAGCTGGGTCCGCCAGG - Intergenic
1123202037 14:106675190-106675212 CTACATGAGCTGGGTCCGCCAGG - Intergenic
1123212636 14:106775341-106775363 CTACATGAGCTGGGTCCGCCAGG - Intergenic
1123401123 15:19987840-19987862 CTACATGAGCTGGGTCCGCCAGG - Intergenic
1123714276 15:23014815-23014837 CTCCATGAGAACAGCCCTCAGGG - Intronic
1123988746 15:25667937-25667959 CTCCATGAGCACAGGCCTGACGG + Intergenic
1124373639 15:29117085-29117107 CGCCATGTTCAGGCTCCTCACGG + Exonic
1125273967 15:37971114-37971136 CTACAGGGGCGGGGTCCTCATGG - Intergenic
1125304208 15:38291514-38291536 CTTCAGGGGCAGGGCCCTCATGG - Intronic
1126825063 15:52540370-52540392 CTGCAGGAGCAGGGCCCTCATGG - Intergenic
1127910394 15:63411596-63411618 CCCCATGAGCAGGGTCTTGATGG + Intergenic
1128718613 15:69928830-69928852 CTGCAGGGGCAGGGCCCTCATGG - Intergenic
1129666268 15:77581181-77581203 CTCCTCCAGCAGGGTCCCCAGGG + Intergenic
1131112729 15:89775862-89775884 CACCATGGGCAGGGCCCTCCGGG + Intronic
1132606575 16:796130-796152 CTCCATGTTCAGGGCCCGCATGG + Intronic
1133308252 16:4825213-4825235 CTTCATGAGCATGGTCTACAGGG + Intronic
1133318026 16:4895888-4895910 CTCCCTGAGCTGGCTCCTTAGGG + Intronic
1134331962 16:13259539-13259561 CTGCAGGGGCAGGGCCCTCATGG - Intergenic
1136009604 16:27354859-27354881 CTCCATAGGCAGGGTCTCCATGG + Intronic
1136795057 16:33009424-33009446 CTACATGAGCTGGGTCCGCCAGG + Intergenic
1136874856 16:33844958-33844980 CTACATGAGCTGGGTCCGCCAGG - Exonic
1138346412 16:56322977-56322999 CTGTATGAGCCTGGTCCTCAGGG - Intronic
1138426827 16:56940195-56940217 CTCCCTGAGCAGATTCCTCATGG + Exonic
1138805664 16:60085979-60086001 CTCTAGGGACAGGGTCCTCATGG - Intergenic
1138859964 16:60744214-60744236 CTACAGGGGCAGGGACCTCATGG - Intergenic
1139753821 16:69126889-69126911 CTCCATCAGGTGTGTCCTCAGGG - Intronic
1140273658 16:73488414-73488436 CCACATCAGCAGGGACCTCATGG + Intergenic
1141618798 16:85225503-85225525 CTCCGTGAGAAGGGTCCCCAGGG + Intergenic
1142048003 16:87938110-87938132 CTTCATGCCCAGGGTCCACATGG + Intergenic
1142120910 16:88386303-88386325 CTCCCTGATAAGGGTCCTCATGG + Intergenic
1142230634 16:88898605-88898627 CCCCATGAGCACCATCCTCAGGG + Intronic
1143653513 17:8279156-8279178 CTCCAGGCACAGGGTCCTTATGG + Intergenic
1143972814 17:10807820-10807842 CTCCATGACCTGGATCCTAAAGG + Intergenic
1144172103 17:12667817-12667839 CTCCAGGATCAGGGTCTTCAGGG - Intronic
1144341351 17:14312834-14312856 CTCCATGGGTGGGGTCCTCATGG - Intronic
1144605175 17:16658423-16658445 CTGCAGGGGCAGAGTCCTCACGG - Intergenic
1145037499 17:19551545-19551567 CTCCAGGACCAGGGACCCCAGGG + Intronic
1146399912 17:32494297-32494319 CTCCCTGAGCTGGGTCCCCAGGG + Exonic
1146682867 17:34821123-34821145 CTCCATGAGCAGAGACAACAAGG + Intergenic
1147962738 17:44177776-44177798 CTCCATGAGGCTGGTCCTGAAGG - Intronic
1149452240 17:56758849-56758871 CTGCAGGGGCAGGGCCCTCACGG + Intergenic
1150333068 17:64309987-64310009 CTCCAGGACCAGGTTCCTCCTGG - Intergenic
1150687395 17:67331746-67331768 CTGCAGGGGCAGGGCCCTCATGG + Intergenic
1151106152 17:71619149-71619171 CTGCAGGGGCAGGGTGCTCATGG + Intergenic
1151336315 17:73441788-73441810 CTCCCTGACCAGGAACCTCATGG + Intronic
1151416833 17:73972097-73972119 ATCCATGAGCAAGATCATCATGG - Intergenic
1152734328 17:81989750-81989772 CTCAAGCAGCAGGGGCCTCAGGG + Intronic
1153469564 18:5428717-5428739 CTTCATGAGCTGGGCCCTCTTGG - Intronic
1153582644 18:6590576-6590598 CTCCATTTGCAGGATCCACACGG - Exonic
1154172950 18:12063883-12063905 CTCCCTGAGCAGGGACCCCATGG + Intergenic
1154504343 18:15020698-15020720 CTACAGGGGCAGGGCCCTCATGG - Intergenic
1154513584 18:15136079-15136101 CTGCAGGGGCAGAGTCCTCATGG - Intergenic
1155851710 18:30782705-30782727 CTGCAGGAACAGGGACCTCATGG + Intergenic
1156243610 18:35276713-35276735 CTGCAGGGGCAGAGTCCTCATGG + Intronic
1156651124 18:39228192-39228214 CTACACGGGCAGGGCCCTCATGG + Intergenic
1156953591 18:42935172-42935194 CTTCCTTAACAGGGTCCTCAGGG - Intronic
1157611572 18:48959962-48959984 CTCCAAGAACAAAGTCCTCACGG + Intergenic
1158222078 18:55160399-55160421 CTACAGGGGCAGGGGCCTCATGG + Intergenic
1159180265 18:64893380-64893402 CTGCAGGGGCAGGGCCCTCATGG - Intergenic
1159731629 18:72034595-72034617 CTGCAAGGGCAGGGCCCTCATGG - Intergenic
1159761287 18:72429969-72429991 CTGTAGGGGCAGGGTCCTCATGG - Intergenic
1159996616 18:74970881-74970903 CTGCAGGGGCAGGGCCCTCATGG - Intronic
1160568708 18:79802279-79802301 CTCCATGAGCCGCGTCCACCTGG - Intergenic
1161127182 19:2564711-2564733 CTCCAGGGGCAGGGTCCTTCCGG - Intronic
1161226839 19:3150796-3150818 CTCCAGGAACAGGGTTCTCCAGG - Intronic
1162528689 19:11222846-11222868 TTCCATGCGCAGGGTCAGCAGGG + Exonic
1162532045 19:11241742-11241764 CTCCCTGCACAGGGGCCTCACGG - Exonic
1163819903 19:19490353-19490375 ACCCATGAGCTGCGTCCTCAGGG - Intronic
1163829534 19:19541114-19541136 CTCCCCGAGCAGGGACCCCACGG - Exonic
1164643381 19:29842422-29842444 CTCCAGGGTCAGGGTCCTGAAGG - Intergenic
1166410050 19:42550673-42550695 CTGCAGGGGCAGGGCCCTCATGG + Intronic
1168699815 19:58430927-58430949 CTCCATCACCAGAGTACTCATGG - Intergenic
1168702449 19:58449302-58449324 CTGCAGGGGCAGGGCCCTCATGG + Intergenic
925749314 2:7073201-7073223 CTGCATGAGCTGGGTCTTGAAGG - Intergenic
925974084 2:9128784-9128806 TTCCATGATCAGGATCCTCGTGG + Intergenic
926938950 2:18115204-18115226 CTGCAGGGGCAGGGCCCTCATGG + Intronic
928410143 2:31048374-31048396 CTACCTGATCAGGCTCCTCATGG - Intronic
928609936 2:32982863-32982885 CTGCAGGGGCAGGGCCCTCATGG + Intronic
929528806 2:42732204-42732226 CTGCAGGGGCAGGGCCCTCATGG - Intronic
930299214 2:49594135-49594157 CTCCAGGAACAGAGCCCTCATGG + Intergenic
930438489 2:51377230-51377252 CTGCAGGAGCAGAGCCCTCATGG + Intergenic
930484852 2:51998977-51998999 CTGTAGGGGCAGGGTCCTCATGG + Intergenic
932282849 2:70509668-70509690 TTGCATGAGCTGGGTACTCAGGG - Intronic
932912266 2:75818278-75818300 CTGCAGGGGCAGGGCCCTCATGG - Intergenic
933047601 2:77558320-77558342 CTGCAGGGGCAGGGTTCTCATGG + Intronic
933350374 2:81145787-81145809 CTGCAGGGGCAGGGCCCTCATGG - Intergenic
933418760 2:82022279-82022301 CTATAGGTGCAGGGTCCTCATGG - Intergenic
935155294 2:100479070-100479092 CTCCAGGAGCAGAGTGCTGAGGG + Intronic
935479059 2:103562128-103562150 CTGCAGGGGCAGGGCCCTCATGG - Intergenic
935625959 2:105172489-105172511 CTGCAGGAGCAGGGCCTTCATGG - Intergenic
937023596 2:118679879-118679901 CTCCATGAGGGGGGCTCTCAGGG - Intergenic
937031523 2:118744708-118744730 CTGCAGGAGCAGGGCCCTCATGG - Intergenic
937309792 2:120895034-120895056 CCCCATCAGCCAGGTCCTCAAGG - Intronic
937332200 2:121038573-121038595 CCCCATGACCAGAGTCCTCATGG - Intergenic
937427660 2:121813550-121813572 CTGCAGGAGCAGGGCCTTCATGG + Intergenic
938165391 2:129021400-129021422 TTGCAGGAGCAGGGCCCTCATGG + Intergenic
938234609 2:129695745-129695767 CTGCAGGGGCAGGGCCCTCATGG + Intergenic
938503532 2:131850904-131850926 CTACAGGGGCAGGGCCCTCATGG - Intergenic
938513824 2:131980690-131980712 CTGCAGGGGCAGAGTCCTCATGG - Intergenic
938698173 2:133853354-133853376 CTGCAGGGGCAGGGTGCTCATGG + Intergenic
939016912 2:136913814-136913836 CTGCAAGGGCAGGGCCCTCATGG + Intronic
939079189 2:137639411-137639433 CTGCAGGGGCAGGGCCCTCATGG + Intronic
939559266 2:143714098-143714120 CTGCAGGGGCAGGGTCCTCATGG - Intronic
939740723 2:145902408-145902430 CTGCAGGGGCAGGGCCCTCATGG + Intergenic
939744476 2:145951983-145952005 CTCCATGGGCATGGGACTCATGG + Intergenic
939752413 2:146063991-146064013 CTGTAGGGGCAGGGTCCTCATGG - Intergenic
939830432 2:147064487-147064509 CTGCAGGGGTAGGGTCCTCATGG + Intergenic
940135935 2:150435964-150435986 CTGCAGGAGCAGGGCACTCATGG + Intergenic
940501964 2:154504564-154504586 CTGCAGGGACAGGGTCCTCATGG + Intergenic
941142793 2:161805951-161805973 CTTCAGGGGCAGGGCCCTCATGG - Intronic
942118158 2:172749273-172749295 CTGCAGGGGCAGGGCCCTCATGG - Intronic
942281097 2:174364547-174364569 CTGCAGGGGCAGGGCCCTCATGG - Intronic
942319597 2:174724838-174724860 CTGCAGGAGCAGGGCTCTCATGG - Intergenic
942903416 2:181151470-181151492 CTCCATGACCTGACTCCTCAGGG - Intergenic
943251226 2:185523576-185523598 CTGCAAGGGCAGGGCCCTCATGG + Intergenic
943303284 2:186229964-186229986 CTGCAAGGGCAGAGTCCTCATGG + Intergenic
943313238 2:186353535-186353557 CTGCAGGGGCAAGGTCCTCATGG + Intergenic
943478177 2:188385144-188385166 CTGCAGGAGTAGGGTCCTCATGG - Intronic
943511261 2:188830435-188830457 CTACAGGGGCAGGGCCCTCATGG + Intergenic
943622738 2:190168040-190168062 CTGCAGGGGCAGGGCCCTCATGG - Intronic
943788182 2:191901555-191901577 CTGCAGGGGCGGGGTCCTCATGG + Intergenic
944010134 2:194965048-194965070 CTCCAGGAGCATGGCCCTCATGG - Intergenic
944101345 2:196031048-196031070 CTGCAAGGGCAGGGCCCTCATGG - Intronic
944921034 2:204413241-204413263 CTGCAGGAGCAGGGCTCTCATGG + Intergenic
945433798 2:209795848-209795870 CTGCAGGTGCAGGGCCCTCATGG + Intronic
946760578 2:222989345-222989367 CTGCAGGGGCAGGGCCCTCATGG - Intergenic
947048722 2:226018556-226018578 CTTCAGGGGCAGGGTCTTCATGG - Intergenic
947134245 2:226961201-226961223 CTCCATGAACGGGGTCATGAGGG + Intronic
948060961 2:235043039-235043061 CTCCATGAGCAGGGTCCTCACGG - Exonic
948378947 2:237540149-237540171 CTCCAGGAGCAGGTTCTGCAGGG - Intronic
948694965 2:239728621-239728643 CTCCATGAGACGGGACCACACGG - Intergenic
948773202 2:240262990-240263012 CTGCAGGGGCAGGGCCCTCATGG + Intergenic
948788313 2:240364570-240364592 CTCCATGAGCATGTTGCACACGG - Intergenic
948906882 2:240983885-240983907 CACCATGAGCAGGGGCCTCTGGG - Intronic
1169249338 20:4048202-4048224 ATCAATGAGCACTGTCCTCATGG - Intergenic
1169845772 20:9989902-9989924 CCCCATGTTCAGGATCCTCATGG + Intronic
1170364920 20:15588034-15588056 CTGCAGGAGCAGGGCCCTCATGG - Intronic
1173046827 20:39520894-39520916 AGCCAAGAGCAGGGTCCGCATGG + Intergenic
1173370459 20:42430137-42430159 ACCCATGAGCAAGGTCCCCACGG + Intronic
1173647726 20:44643986-44644008 GTCCAAGACCTGGGTCCTCATGG - Intronic
1173711055 20:45156049-45156071 CTTCAGGAGCAGGGCCATCATGG + Intergenic
1174355948 20:49998059-49998081 CTGCATGAGCAGGTACCCCAGGG + Intergenic
1175246446 20:57585055-57585077 TTCCCTGACCAGGGTCCCCATGG - Intergenic
1175677606 20:60960232-60960254 CTCCAGGTGCAGGCTCCTCTGGG - Intergenic
1175778426 20:61667263-61667285 CTCCGTGAGCAGGGCCATCCCGG - Intronic
1176117697 20:63440207-63440229 CTCCTGGAGCAGGGACCCCAGGG + Intronic
1177026319 21:15925539-15925561 CTGCAGGGGCAGGGTCCTCATGG - Intergenic
1177067955 21:16464135-16464157 CTGCAAGGGCAGGGCCCTCATGG + Intergenic
1177504287 21:22000668-22000690 CTGCAGGGGCAGGGCCCTCAAGG - Intergenic
1177722678 21:24928199-24928221 CTGCATGGGCAGAGCCCTCATGG + Intergenic
1177740285 21:25146143-25146165 CTGCAGGGGCAGGGTCTTCATGG - Intergenic
1177977611 21:27871231-27871253 CTGCAGGGGCAGAGTCCTCATGG + Intergenic
1177992886 21:28059232-28059254 CTACAGGGGCAGGGTCCTCATGG + Intergenic
1179235294 21:39540323-39540345 CTGCAGGTGCAGGGCCCTCATGG - Intergenic
1179271944 21:39858350-39858372 CTGCAGGGGCAGAGTCCTCATGG - Intergenic
1179316405 21:40247853-40247875 CTGCAGGGGCATGGTCCTCATGG - Intronic
1179332082 21:40413134-40413156 CTGCAGGGGCAGGGCCCTCATGG + Intronic
1179964196 21:44791633-44791655 CTGCAGGGGCAGGGCCCTCATGG + Intronic
1182650629 22:31848356-31848378 CTTCAGGGGCAGGGCCCTCATGG - Intronic
1183219542 22:36503891-36503913 CTCCAGGACCAAGGGCCTCAGGG + Intronic
1183691039 22:39388613-39388635 CTCGCTGAGCAGCGGCCTCAGGG - Intergenic
1185042879 22:48514576-48514598 CTCCCTGGGCAGGGTCTGCAGGG - Intronic
1185046236 22:48529968-48529990 ATCCATGAGCTTAGTCCTCAGGG - Intronic
949712138 3:6883789-6883811 TTCTATAAGCAGGATCCTCACGG - Intronic
950800758 3:15550344-15550366 CTGCAGGGGCAGGGCCCTCATGG + Intergenic
951058217 3:18172974-18172996 CTGCAGGGGCAGGGCCCTCATGG - Intronic
951177137 3:19615225-19615247 CTGCAGGGGCAGGGCCCTCATGG - Intergenic
951324848 3:21288937-21288959 CTCCATGGGCAGAGTTCTCAGGG + Intergenic
952105526 3:30065495-30065517 CTGTAGGGGCAGGGTCCTCATGG - Intergenic
953381029 3:42473160-42473182 CTACATGGGCTGGGTCCTGATGG - Intergenic
953551234 3:43905007-43905029 CTACAGGAGCAGGTTCCTAAGGG + Intergenic
953742649 3:45550870-45550892 CTCCGTGAGCAGGAACTTCATGG - Intergenic
954131977 3:48565501-48565523 AGCCAAGAGCAGGGGCCTCAGGG + Intronic
954877073 3:53809181-53809203 CTCCATGGGCAGGGCCCTGTGGG + Intronic
956185674 3:66559855-66559877 CTGCAGGGGCAGGGCCCTCATGG - Intergenic
956245768 3:67181240-67181262 CTCCATGAGGAAGGTCGGCATGG + Intergenic
956354671 3:68378026-68378048 CTTCAAGGGCAGGGCCCTCATGG + Intronic
956363224 3:68471225-68471247 CTGCAGGGGCAGGGCCCTCATGG + Intronic
956474972 3:69610128-69610150 CTGCAGGGGCAGGGCCCTCATGG + Intergenic
957105638 3:75883595-75883617 CTTCAGGGGCAGGGCCCTCATGG - Intergenic
957148705 3:76457675-76457697 CTGCACGGGCAGGGCCCTCATGG - Intronic
957276106 3:78093372-78093394 CTGCAAGGGCAGGGCCCTCATGG + Intergenic
957654854 3:83061113-83061135 CTACAGGGGCAGAGTCCTCATGG - Intergenic
957704014 3:83756089-83756111 CTGCAGGGGCAGGGCCCTCATGG + Intergenic
957857292 3:85894936-85894958 CTGCAGGGGCAGGGCCCTCATGG + Intronic
959172022 3:102855068-102855090 TTGCAAGAGCAGGGCCCTCACGG - Intergenic
959183170 3:103007870-103007892 CTGCAGGAGCAGAGCCCTCATGG - Intergenic
959624351 3:108432863-108432885 CTGCAGGAGCGGGGCCCTCATGG + Intronic
959788806 3:110332586-110332608 CTGCAGGGGCAGGGCCCTCATGG - Intergenic
961052016 3:123755061-123755083 CTGTATGAGCAGAGTCCTGAGGG - Intronic
962045788 3:131758020-131758042 CTGCAGGGGCAGGGCCCTCATGG + Intronic
962711098 3:138086742-138086764 GTCCAGGAGCAGGGGCCTCCAGG - Intronic
963072815 3:141318972-141318994 CTGCAGGGGCAGGGCCCTCATGG - Intergenic
963394551 3:144715317-144715339 CTGCAGGGGCAGGGGCCTCATGG - Intergenic
963906716 3:150779194-150779216 CTCGATGCGCAGGGACCTCAAGG - Intergenic
964589204 3:158341594-158341616 CTGCAGGAGCAGGGCCCTAATGG + Intronic
965395045 3:168152882-168152904 CTGCAGGAGCAGAGCCCTCATGG + Intergenic
965864074 3:173183451-173183473 CTGCAGGGGCAGGGCCCTCATGG + Intergenic
966123381 3:176547936-176547958 CTGCAGGGGCAGGGCCCTCATGG - Intergenic
966446560 3:180007590-180007612 CTGCAGGGGCAGGGCCCTCATGG - Intronic
966467732 3:180250430-180250452 CTACTTGAGCAGGGTCTTGAAGG + Intergenic
966932509 3:184685113-184685135 CTCCAGGAACAGGGTCCTTTCGG + Intergenic
967450041 3:189613475-189613497 CTGCATGAGCAGGGCCCTCATGG + Intergenic
967509411 3:190292156-190292178 CTGCAGGAGCAGAGCCCTCATGG - Intergenic
967717143 3:192775396-192775418 CTGCAGGAGCAGGGCCCTCATGG + Intergenic
968402972 4:314809-314831 CTGCAGGGGCAGGGCCCTCATGG - Intergenic
968600396 4:1505999-1506021 CTCCAGAAGCAGGGTCCCGAGGG + Intergenic
969190301 4:5513002-5513024 CTGCAGGGGCAGGGTCCTCATGG - Intergenic
970357420 4:15269646-15269668 CTGCAGGGGCAGGGTGCTCATGG + Intergenic
970577714 4:17444132-17444154 CTGCAGGAGCAGAGCCCTCATGG - Intergenic
970624392 4:17861191-17861213 CTGCAGGGGCAGGGCCCTCATGG - Intronic
970976489 4:22048189-22048211 CTGCAGGGGCAGGGCCCTCATGG - Intergenic
971119651 4:23689571-23689593 CTGCATGGGCAGAGCCCTCATGG + Intergenic
971499233 4:27300587-27300609 CTGCAGGAGCAGAGCCCTCATGG - Intergenic
972056175 4:34806072-34806094 CTGCAGGAGCGGGGCCCTCATGG - Intergenic
973107784 4:46361516-46361538 CTGCAGGGGCAGGGCCCTCATGG + Intronic
975214562 4:71738453-71738475 CTGCAGGGGCAGGGCCCTCATGG + Intergenic
975627005 4:76360265-76360287 CTGCAGGAGCAGAGCCCTCATGG + Intronic
976128021 4:81854320-81854342 CTGCAGGGGCAGGGCCCTCATGG - Intronic
976405592 4:84658060-84658082 CTGCAGGGGCGGGGTCCTCATGG - Intergenic
976442290 4:85089242-85089264 CCACAGGGGCAGGGTCCTCATGG + Intergenic
977189147 4:93977948-93977970 CTGCAGGGGCAGGGTTCTCATGG + Intergenic
977396569 4:96478797-96478819 CTGCAGGGGCAGGGTCCTCATGG + Intergenic
977705297 4:100064067-100064089 CTGGATAAGCAGGGTCCACATGG + Intergenic
978920277 4:114175338-114175360 CTGCAGGGGCAGGGTCCTCATGG - Intergenic
978983690 4:114983102-114983124 CTGCAGGAGCAGAGCCCTCATGG + Intronic
979177153 4:117679357-117679379 CTGCAGGGGCAGGGTGCTCATGG + Intergenic
979182860 4:117753293-117753315 CTGCAGGAGCAGGGCCCTCTTGG + Intergenic
979327856 4:119400072-119400094 CTGCAGGAGCGGGGTCCTCATGG - Intergenic
979391891 4:120138083-120138105 CTGCAGAGGCAGGGTCCTCATGG - Intergenic
979856175 4:125637133-125637155 CTGCAGGGGCAGGGCCCTCATGG - Intergenic
980308893 4:131101162-131101184 CTGCAGGAGCAGGGCACTCATGG + Intergenic
981275419 4:142893523-142893545 CTGCAGGAGCAGAGCCCTCATGG + Intergenic
981799334 4:148637382-148637404 CTGCAAGGGCAGGGCCCTCATGG - Intergenic
981845774 4:149166938-149166960 CTTCAAGACCAGGGTCATCATGG - Intergenic
982430346 4:155315316-155315338 CTGCAAGGGCAGGGCCCTCATGG + Intergenic
982477216 4:155868220-155868242 CTACAGGGGCAGGGCCCTCATGG - Intronic
982478349 4:155879053-155879075 CTGCAGGGGCAGAGTCCTCATGG - Intronic
982482995 4:155934342-155934364 CTGCAGGAGCAGGGCCCTCATGG + Intronic
982504922 4:156205483-156205505 CTGCATGGGCAGAGCCCTCATGG - Intergenic
982948881 4:161663799-161663821 CTGCAGGGGCAGGGCCCTCATGG - Intronic
983245606 4:165283793-165283815 CTGCAGGGGCGGGGTCCTCATGG - Intronic
983340512 4:166454862-166454884 CTGTAGGGGCAGGGTCCTCATGG + Intergenic
983489197 4:168368464-168368486 CTGCAGGAGCAGGGCCCCCATGG + Intronic
983785926 4:171729354-171729376 CTGTAGGGGCAGGGTCCTCATGG + Intergenic
983874766 4:172863147-172863169 CTGCAGGGGCAGGGACCTCATGG + Intronic
984327110 4:178268799-178268821 CTGCAGGGGCAGGGCCCTCATGG - Intergenic
985159973 4:187034246-187034268 CTGCAGGGGCAGGGCCCTCATGG + Intergenic
985220320 4:187697079-187697101 CTGCAGGAGCAGAGCCCTCATGG + Intergenic
985287727 4:188354170-188354192 CTCCATGAGCAGGGTCTTCTTGG + Intergenic
985486861 5:156711-156733 CACCAAGAGCAGATTCCTCAAGG + Intronic
986132246 5:4942402-4942424 CTCCTGGCCCAGGGTCCTCAGGG - Intergenic
986640598 5:9868266-9868288 CTTCAGGGGCAGGGCCCTCATGG - Intergenic
986948013 5:13047926-13047948 CTGCACGGGCAGGGTTCTCATGG - Intergenic
987292526 5:16522145-16522167 CTCCAGGAGCTGGTTCCTCTTGG - Intronic
987312697 5:16695873-16695895 CTAGATGAGCAGGGGCCTCTTGG - Intronic
987435266 5:17885812-17885834 CTGTAGGGGCAGGGTCCTCATGG + Intergenic
987659573 5:20855066-20855088 CTGCAGGGGCAGGGCCCTCATGG + Intergenic
987984911 5:25134124-25134146 CTGCAGGGGCAGGGCCCTCATGG + Intergenic
988099244 5:26656822-26656844 CTTCAGGAGCAGAGCCCTCATGG - Intergenic
988172944 5:27682849-27682871 CTGCAGGGGCAGGGCCCTCATGG - Intergenic
988379410 5:30481012-30481034 CTACAGGAGCAGAGCCCTCATGG - Intergenic
988656385 5:33216504-33216526 AACCATGAGCAGAGCCCTCATGG + Intergenic
988764071 5:34350581-34350603 CTGCAGGGGCAGGGCCCTCATGG - Intergenic
988836447 5:35037266-35037288 CTCCAAGAGCAGGGTTCAAAAGG + Intronic
988902752 5:35751652-35751674 TTTCATGTGCAGGCTCCTCAAGG + Intronic
990125938 5:52518094-52518116 CTGCAGGGGCAGGGCCCTCATGG + Intergenic
990563835 5:57009257-57009279 CTCCATTGGCAGGGTACTCTTGG - Intergenic
990844561 5:60122351-60122373 CTGCAGGGGCAGGGCCCTCATGG - Intronic
991119416 5:62994109-62994131 CTGCAGGGGCAGGGCCCTCATGG - Intergenic
991424035 5:66472362-66472384 CTGGGTGATCAGGGTCCTCATGG - Intergenic
992215854 5:74524140-74524162 CTGCAGGGGCAGGGCCCTCATGG + Intergenic
992279561 5:75160786-75160808 CTCTATGAACAGTGTTCTCATGG + Intronic
992279714 5:75161965-75161987 CTGCAAGGGCAGGGCCCTCATGG + Intronic
993293824 5:86109191-86109213 CTGCAGGGGCAGGGTCCTCCTGG + Intergenic
993638224 5:90371187-90371209 CTCCAGGGGCAGGGCACTCATGG - Intergenic
993761285 5:91800223-91800245 CTTCGTGGTCAGGGTCCTCATGG - Intergenic
993893692 5:93505493-93505515 CTGCAGGGGCAGGGCCCTCATGG - Intergenic
994338789 5:98601026-98601048 CTGCAGGGGCAGGGCCCTCATGG + Intergenic
994434302 5:99708213-99708235 CTGCAGGGGCAGGGCCCTCATGG - Intergenic
994553181 5:101262354-101262376 CTGCAGGAGTAGGGCCCTCATGG + Intergenic
994828543 5:104747196-104747218 CTGCAGGGGCAGGGCCCTCATGG + Intergenic
996177596 5:120378693-120378715 CTGCAGGGGCAGGGCCCTCATGG + Intergenic
996460194 5:123732729-123732751 CCCCAGGGGCAGGGCCCTCATGG + Intergenic
996526851 5:124489143-124489165 CTGCAGGGGCAGGGCCCTCATGG - Intergenic
996774732 5:127121115-127121137 CTGCAGGGGCAGAGTCCTCATGG - Intergenic
997057310 5:130459982-130460004 CTGCAGGGGCAGGGCCCTCATGG + Intergenic
997081725 5:130747103-130747125 CTGCAGGGGCAGGGCCCTCATGG + Intergenic
997091554 5:130864497-130864519 CTGCAGGGGCAGAGTCCTCATGG - Intergenic
997102064 5:130980463-130980485 CTGCAGGGGCAGAGTCCTCATGG - Intergenic
997108227 5:131045843-131045865 CTGCAGGGGCAGGGTCATCATGG - Intergenic
998745865 5:145259183-145259205 CTGCAGGAGCAGAGCCCTCATGG + Intergenic
998889365 5:146729839-146729861 CTGCAGGGGCAGGGCCCTCATGG + Intronic
999264209 5:150255955-150255977 CTCCTTCAGCAGGGACTTCATGG - Intronic
999668118 5:153934463-153934485 CTGCAGGGGCAGGGCCCTCATGG - Intergenic
1000062973 5:157672356-157672378 CTCCATGGACAGGGGCCTGAAGG - Intronic
1000648414 5:163785692-163785714 CTGCAGGGGCAGGGCCCTCATGG - Intergenic
1001352284 5:170980722-170980744 CTACAGGAGCGGGGCCCTCATGG + Intronic
1001876307 5:175204662-175204684 CCCCATCCGCAGGGTCCCCATGG - Intergenic
1003401739 6:5796290-5796312 CTGCAGGGGCAGGGCCCTCATGG - Intergenic
1003684847 6:8292287-8292309 CCCCATGGCCAGGGTCCACATGG + Intergenic
1003844777 6:10161720-10161742 CTGCATGAGCAGATTCCTTAAGG + Intronic
1005499598 6:26418256-26418278 CTGCAGGAGCAGAGCCCTCATGG - Intergenic
1005904978 6:30254746-30254768 CTGCAGGGGCAGGGCCCTCACGG - Intergenic
1005921733 6:30407687-30407709 CTGCAGGGGCAGGGCCCTCATGG + Intergenic
1006240417 6:32673008-32673030 CTTCAGGAACAGGGACCTCATGG + Intergenic
1006772063 6:36561929-36561951 CTCCCTGAGCAGAGACCTGAAGG - Intergenic
1008332724 6:50262451-50262473 CTGCAGGGGCAGGGCCCTCATGG - Intergenic
1008756149 6:54797378-54797400 CTGCAGGAGCAGGGCCCTCATGG + Intergenic
1009242467 6:61198874-61198896 CTGCAGGAGCAGAGTCCTCATGG + Intergenic
1009377537 6:62990866-62990888 CTGCAGGGGCAGGGCCCTCATGG - Intergenic
1009559518 6:65221581-65221603 CTGCAGGGGCAGGGCCCTCATGG + Intronic
1009980443 6:70720572-70720594 CTGCAGGGGCAGGGTCCTCATGG - Intronic
1010360463 6:74987265-74987287 CTGCAGGAGCAGAGCCCTCATGG + Intergenic
1011110637 6:83833753-83833775 CTGTAGGGGCAGGGTCCTCAGGG + Intergenic
1011152510 6:84289991-84290013 CTGTAGGGGCAGGGTCCTCAGGG - Intergenic
1011439148 6:87369265-87369287 CTGCAGGGGCAGGGCCCTCATGG - Intronic
1011461942 6:87614068-87614090 CTGTAGGGGCAGGGTCCTCATGG - Intronic
1011835086 6:91421559-91421581 CTGCAGGAGCGGGGTCCTCATGG + Intergenic
1011942279 6:92857373-92857395 CTACAGGGGCAGGGCCCTCATGG - Intergenic
1012194166 6:96318150-96318172 CTGCAGGTGCAGGGTGCTCATGG - Intergenic
1012213747 6:96556872-96556894 CTGCAGGGGCGGGGTCCTCATGG - Intergenic
1012271315 6:97215648-97215670 CTTGATGAGCAGTGTCCTGAGGG - Intronic
1012756673 6:103240526-103240548 CTGCAGGGGCAGGGCCCTCATGG + Intergenic
1013095917 6:106944825-106944847 CTCCATGCCCAGGGTACTGAGGG - Intergenic
1013863154 6:114660626-114660648 CTGCAGGGGCAGGGCCCTCATGG + Intergenic
1013865454 6:114690912-114690934 CTGCAGGAGCGGGGCCCTCATGG - Intergenic
1013935384 6:115587510-115587532 CTACAGGGGCAGGGCCCTCATGG + Intergenic
1014407011 6:121064786-121064808 CTTCAGGGGCAGGGCCCTCATGG + Intergenic
1014449385 6:121565604-121565626 CTGCAGGGGCAGGGTGCTCATGG + Intergenic
1014691693 6:124570687-124570709 CTGCAGGGGCAGGGCCCTCATGG + Intronic
1014895219 6:126892894-126892916 CTGCAGGAGCAGAGCCCTCATGG + Intergenic
1015523199 6:134151738-134151760 CTGCAGGGGCAGGGCCCTCATGG + Intergenic
1015674206 6:135726315-135726337 CTGCAGGGGCAGGGCCCTCATGG + Intergenic
1015677086 6:135762291-135762313 CTGCAAGAGTAGGGCCCTCATGG - Intergenic
1015815691 6:137208722-137208744 CTGCAGGGGCAGGGCCCTCATGG + Intronic
1016108193 6:140188619-140188641 CTGCAGGAGCAGGGTCCTCAGGG + Intergenic
1016176326 6:141081485-141081507 CTCCAGGGGTGGGGTCCTCATGG + Intergenic
1016208974 6:141505368-141505390 CTGCAGGGGCAGGGCCCTCATGG - Intergenic
1016230642 6:141800296-141800318 CTGCAGGGGCAGGGCCCTCATGG + Intergenic
1016537642 6:145126447-145126469 CTACAGGGGCAGGGCCCTCATGG + Intergenic
1016649588 6:146448459-146448481 CTGCAGGGGCAGGGTGCTCATGG - Intergenic
1018462077 6:164007906-164007928 CTCAATTTGCAGGGTCCTCTTGG + Intergenic
1018636424 6:165863170-165863192 CACCTGGAGCAAGGTCCTCACGG - Intronic
1019308193 7:346384-346406 GTCGATGAGCCTGGTCCTCACGG + Intergenic
1019448708 7:1084848-1084870 CTGCAGGAGCAGAGCCCTCAGGG - Intronic
1019523460 7:1470589-1470611 CTCCATATGCAGGATCCTCAGGG + Exonic
1019952584 7:4385509-4385531 CCCCAGGAGAAGTGTCCTCATGG + Intergenic
1021326309 7:19273471-19273493 CTGCAGGAGCAGGGGCCTCATGG - Intergenic
1021598586 7:22342046-22342068 CTGCAGGAGCAGGGCCCTCATGG - Intronic
1022579160 7:31531053-31531075 CTCCCAGAGCAGGCTCCTCCAGG + Intronic
1022896022 7:34751136-34751158 CTGGCTGAGCAGGGTCCTGAAGG + Intronic
1023188529 7:37555399-37555421 CTGCAGGAGCAGAGCCCTCATGG - Intergenic
1023268081 7:38429533-38429555 CTCCATGATCAGGTTACACAAGG + Intronic
1023456157 7:40340805-40340827 CTTGATGATCAGGGTGCTCACGG + Intronic
1024158277 7:46648283-46648305 CTGCAGGGGCAGGGCCCTCATGG - Intergenic
1024843971 7:53620581-53620603 CTGCAAGGGCAGAGTCCTCAGGG + Intergenic
1025008094 7:55370732-55370754 CTCCATGAGCAAGGACTTAAGGG + Intronic
1025641586 7:63377829-63377851 CTCCATGAGCTTCATCCTCAGGG + Intergenic
1026322809 7:69282313-69282335 CTGCAGGAGGAGGGTCCCCAGGG - Intergenic
1026329158 7:69337019-69337041 GTCCATGAGCAGCCTCTTCATGG + Intergenic
1028023709 7:85809183-85809205 ATGCAGGTGCAGGGTCCTCATGG + Intergenic
1028054169 7:86222734-86222756 CTGCAGGGGCAGGGCCCTCATGG - Intergenic
1028249686 7:88526220-88526242 CTGCAGGGGCAGGGCCCTCATGG - Intergenic
1028314506 7:89383774-89383796 CTGTAGGAGCAGGCTCCTCATGG + Intergenic
1030431054 7:109449702-109449724 CTCCCTGAGCAAGCTGCTCAAGG + Intergenic
1030628977 7:111874282-111874304 CACATTGAGCAGGGTCCTGATGG - Intronic
1030784266 7:113640851-113640873 CTGCAGGAGCAGGGCGCTCATGG - Intergenic
1030806838 7:113929798-113929820 CTGCAGGGGCAGGGCCCTCATGG + Intronic
1030970061 7:116045607-116045629 CTGCAGGGGCAGGGCCCTCAAGG + Intronic
1031158194 7:118135514-118135536 CTGCAGGGGCAGGGCCCTCATGG + Intergenic
1031473176 7:122191498-122191520 CTGCAGGGGCAGGGCCCTCATGG + Intergenic
1031583456 7:123505404-123505426 CTGCAGGAGCAGAGCCCTCATGG - Intronic
1031674245 7:124589313-124589335 CTCTAGGAGGGGGGTCCTCATGG + Intergenic
1032537590 7:132677839-132677861 GGCCATGAGCAGGGTCATGAAGG - Intronic
1033031585 7:137832302-137832324 CTACAGGGGCAGGGCCCTCATGG - Intronic
1033585734 7:142773172-142773194 GTCCATGAGCAGGGAGCTTAAGG + Intergenic
1033910715 7:146260237-146260259 CTTCATGGGCAGAGCCCTCATGG + Intronic
1034467724 7:151239623-151239645 CTCCCAGAGCCGGGACCTCAAGG - Exonic
1034969494 7:155410264-155410286 GCCCAGGTGCAGGGTCCTCAGGG - Intergenic
1037048840 8:14343182-14343204 CTGCATGGGCAGGGCCCTCATGG + Intronic
1037952363 8:23027687-23027709 CTCCAGGAGCTGGGGGCTCAGGG - Intronic
1038298979 8:26324541-26324563 CTGCAGGGGCAGGGCCCTCATGG + Intronic
1038652779 8:29420815-29420837 ATCCATGAGCAGGGGCCTGGAGG + Intergenic
1038684320 8:29702600-29702622 CTGCAGGAGCAGAGCCCTCATGG + Intergenic
1039466437 8:37788342-37788364 GAGCATGAGCAGGGTCATCAGGG + Intronic
1040925850 8:52681875-52681897 CTGCAGGGGCAGGGCCCTCATGG + Intronic
1041222962 8:55670233-55670255 CTACAGGGGCAGGGCCCTCATGG + Intergenic
1041351378 8:56951050-56951072 CTGCAGGGGCAGGGCCCTCATGG - Intergenic
1042466331 8:69133361-69133383 CTGCAGGAGCAGGGCCCTCACGG - Intergenic
1042728333 8:71903055-71903077 CTGCAGGGGCAGGGGCCTCATGG - Intronic
1042772937 8:72398819-72398841 CTGCAGGGGCAGGGCCCTCATGG - Intergenic
1042837746 8:73093047-73093069 CGCCATCCACAGGGTCCTCATGG + Exonic
1043694768 8:83204640-83204662 CTGCAGGGGCAGGGCCCTCATGG + Intergenic
1043704382 8:83330306-83330328 CTGCAGGAGCAGAGCCCTCATGG - Intergenic
1043776627 8:84278080-84278102 CTGCAGGGGCAGGGTCTTCATGG - Intronic
1043993144 8:86780755-86780777 CTGCAGGGGCAGGGCCCTCATGG + Intergenic
1045105902 8:98892419-98892441 AACCATTAGCTGGGTCCTCAAGG + Intronic
1045695286 8:104802320-104802342 CTGCCTGAGCAGGGTCCTATGGG + Intronic
1046372204 8:113324595-113324617 CTGCATGGGCAGGGTCTTCACGG + Intronic
1046656351 8:116899323-116899345 CTGCAGGGGCAGGGCCCTCATGG + Intergenic
1046814783 8:118571799-118571821 CTGTAGGGGCAGGGTCCTCATGG + Intronic
1047105154 8:121724043-121724065 CTCCATCCTCAGGGACCTCACGG - Intergenic
1047115971 8:121842356-121842378 CTGCAGGGGCAGGGCCCTCATGG + Intergenic
1047149170 8:122241375-122241397 CTGTAGGGGCAGGGTCCTCATGG + Intergenic
1047153761 8:122294518-122294540 CTGCAAGGGCAGGGCCCTCATGG - Intergenic
1047750924 8:127879860-127879882 CTCCATGAGAAGGGTGCGCTGGG - Intergenic
1048706017 8:137154641-137154663 CTGCAGGTGCAGGGCCCTCAGGG + Intergenic
1048786184 8:138052853-138052875 CTGCATGAACAGTTTCCTCATGG - Intergenic
1049206441 8:141365800-141365822 CTCCCTGAGGAGGGGCGTCAGGG - Intronic
1049632233 8:143664990-143665012 CCCCATGAGCAATGTTCTCAGGG - Intergenic
1049784070 8:144442268-144442290 CTCCATGAACCGCTTCCTCATGG + Exonic
1050695552 9:8275758-8275780 CTACAGGGGCAGGGTCCTCATGG - Intergenic
1050915210 9:11122585-11122607 CTGCATGGGCAGAGCCCTCATGG - Intergenic
1051860815 9:21623087-21623109 CTGCAGGGGCAGGGTGCTCATGG - Intergenic
1052032089 9:23640289-23640311 CTCCATGAGCATGATACTGAGGG + Intergenic
1052035287 9:23673701-23673723 GTACAAGAGCAGGGGCCTCAAGG + Intergenic
1052594137 9:30536965-30536987 CTGCAGGGGCAGGGTCCTCATGG + Intergenic
1053675401 9:40420766-40420788 CTGCAGGGGCAGGGTGCTCATGG + Intergenic
1053925191 9:43047103-43047125 CTGCAGGGGCAGGGTGCTCATGG + Intergenic
1054288673 9:63259292-63259314 CTGCAGGGGCAGGGTGCTCATGG + Intergenic
1054386499 9:64560829-64560851 CTGCAGGGGCAGGGTGCTCATGG + Intergenic
1054509221 9:65955526-65955548 CTGCAGGGGCAGGGTGCTCATGG - Intergenic
1054983575 9:71235398-71235420 CTCCATGATCATGGGCCTCATGG - Intronic
1055142003 9:72886835-72886857 CTGCAGGGGCAGGGCCCTCATGG + Intergenic
1055829257 9:80359920-80359942 AGCCAGGAGGAGGGTCCTCAGGG + Intergenic
1055944332 9:81679324-81679346 CTTCCTGAGCAGGGTCCACAGGG - Intronic
1056092231 9:83216594-83216616 CTGGAGGAGCAGGGCCCTCATGG + Intergenic
1056129203 9:83567042-83567064 CTGCAGGGGCAGGGCCCTCATGG - Intergenic
1056778206 9:89529500-89529522 CTCCATGAGCAGCATACCCAGGG - Intergenic
1056924374 9:90820358-90820380 CTGCAGGGGCAGGGCCCTCATGG - Intronic
1058076544 9:100657319-100657341 CTGCAGGGGCAGGGCCCTCATGG + Intergenic
1058210446 9:102161458-102161480 CTGCAGGGGCAGGGCCCTCATGG - Intergenic
1058288559 9:103209919-103209941 CTGCATGAGCAGAGCCATCATGG - Intergenic
1058810029 9:108630495-108630517 CTGCAGGGGCAGGGCCCTCATGG + Intergenic
1059753601 9:117272069-117272091 CTGCAGGGGCAGGGCCCTCATGG - Intronic
1059843315 9:118242926-118242948 CTGCAGGGGCAGGGCCCTCATGG - Intergenic
1060653606 9:125352299-125352321 CCGCAGGGGCAGGGTCCTCATGG - Intronic
1061381247 9:130259445-130259467 GTCCATGGGCTGTGTCCTCATGG + Intergenic
1062539382 9:137034856-137034878 CACCCTGCCCAGGGTCCTCAAGG - Exonic
1062556720 9:137116134-137116156 CTCCAGGAGCAGGGTTTCCAAGG + Intergenic
1186093429 X:6074289-6074311 CTCCATGAGCAGAGTTTCCATGG + Intronic
1186165287 X:6820965-6820987 CTGCAGGGGCAGGGCCCTCATGG - Intergenic
1186279044 X:7972871-7972893 CTCCAGGAGCAGAGTCTTTAAGG - Intergenic
1187097345 X:16162323-16162345 CTGCAGGGGCAGGGCCCTCATGG - Intergenic
1187603773 X:20861559-20861581 CTGCAGGAGCAGAGCCCTCATGG + Intergenic
1187796180 X:23006561-23006583 CTGCAGGGGCAGGGCCCTCAAGG - Intergenic
1187894410 X:23966920-23966942 CTGCAGGGGCAGGGACCTCATGG - Intergenic
1188587941 X:31800227-31800249 CTGCAGGGGCAGGGCCCTCATGG - Intronic
1188755148 X:33952959-33952981 CTACAGGGGCAGGGCCCTCATGG - Intergenic
1188764987 X:34080336-34080358 CTGCAGGGGCAGGGCCCTCATGG - Intergenic
1188925928 X:36043880-36043902 CTACAGGGGCAGAGTCCTCATGG - Intronic
1189228779 X:39435672-39435694 CTGCAGGAGCAGGGTCCTCACGG - Intergenic
1189637185 X:43023530-43023552 CTGCAGGGGCAGGGCCCTCATGG - Intergenic
1189652777 X:43208228-43208250 CTGCAGGGGCAGAGTCCTCATGG + Intergenic
1190513273 X:51195607-51195629 CTGCAGGGGCAGGGCCCTCATGG - Intergenic
1190514319 X:51207118-51207140 CTGTAGGGGCAGGGTCCTCATGG + Intergenic
1191873348 X:65769208-65769230 CTGCAGGAGCAGAGACCTCATGG + Intergenic
1192309442 X:69997958-69997980 CTGCAGGGGCAGGATCCTCATGG + Intronic
1193449199 X:81645414-81645436 CTGTAGGGGCAGGGTCCTCATGG + Intergenic
1193497957 X:82237437-82237459 CTCCATGGGCAGAGCCCTGAGGG - Intergenic
1193529838 X:82643119-82643141 CTGCAGGGGCAGGGCCCTCATGG - Intergenic
1193593994 X:83423300-83423322 CTGCAGGAGCAGAGCCCTCATGG + Intergenic
1193707868 X:84844829-84844851 CTGCAGGGGCAGGGCCCTCATGG - Intergenic
1193711348 X:84884097-84884119 CTGCAGGGGCAGGGCCCTCATGG + Intergenic
1193962864 X:87947349-87947371 CTGCAAGGGCAGGGCCCTCATGG + Intergenic
1193981355 X:88185579-88185601 CTGCAGGAACAGGGCCCTCATGG + Intergenic
1194014183 X:88599089-88599111 CTGCAGGAGCAGAGCCCTCATGG - Intergenic
1194321136 X:92447612-92447634 CTGCAGGGGCAGGGCCCTCATGG + Intronic
1194527006 X:94989468-94989490 CTGCAGGGGCAGGGCCCTCATGG - Intergenic
1194548879 X:95272409-95272431 CTGCAGGGGCAGGGCCCTCATGG - Intergenic
1194850246 X:98860107-98860129 CTTCAGGGGCAGGGCCCTCATGG + Intergenic
1195863729 X:109407886-109407908 CTGCAGGAGCAGGACCCTCATGG + Intronic
1196246306 X:113404095-113404117 CTACAGGGGCAGAGTCCTCATGG + Intergenic
1196391350 X:115210519-115210541 CTGCAGGGGCAGGGACCTCATGG + Intronic
1197341037 X:125266608-125266630 CTGCAGGAGTAGGGACCTCATGG + Intergenic
1197437754 X:126453126-126453148 CTTCAGGGGCAGGGCCCTCATGG + Intergenic
1197473401 X:126890858-126890880 CTGCAGGGGCAGAGTCCTCAAGG - Intergenic
1198497143 X:137204138-137204160 CTGCAGGAGCAGGGCACTCATGG - Intergenic
1198775291 X:140172879-140172901 CTGCAGGGGCAGAGTCCTCATGG + Intergenic
1198872830 X:141193963-141193985 CTCCAGGGGCAGGGCCCTCATGG + Intergenic
1199027878 X:142961127-142961149 CTGCAGGGGCAGGGCCCTCATGG - Intergenic
1199070394 X:143469046-143469068 CTACAGCAGCAGGGCCCTCATGG - Intergenic
1199113264 X:143959382-143959404 CTGCAAGGGCAGAGTCCTCATGG - Intergenic
1199220526 X:145311084-145311106 CTGCAGGAGCAGAGCCCTCATGG - Intergenic
1199258890 X:145748122-145748144 CTTCAGGAGCAGAGCCCTCATGG - Intergenic
1199317781 X:146400715-146400737 CTGCAAGGGCAGGGCCCTCATGG + Intergenic
1199569370 X:149252297-149252319 CTCCAGGGGCAGGGCGCTCATGG - Intergenic
1199580797 X:149358068-149358090 CTGCAGGGGCAGGGCCCTCATGG + Intergenic
1199868772 X:151877670-151877692 CTTCAGGGGCAGGGCCCTCATGG - Intergenic
1200048480 X:153415375-153415397 TTCACTGAGCAGTGTCCTCAGGG + Intergenic
1200376345 X:155784461-155784483 CTCACTGAGCAGGGTCCTTCAGG + Intergenic
1200437224 Y:3165954-3165976 CTGCAGGGGCAGGGTCCTAATGG - Intergenic
1200614971 Y:5368551-5368573 CTGCAGGGGCGGGGTCCTCATGG + Intronic
1200629254 Y:5560759-5560781 CTGCAGGGGCAGGGCCCTCATGG + Intronic