ID: 948060965

View in Genome Browser
Species Human (GRCh38)
Location 2:235043076-235043098
Sequence GCGCTCCTTCGCTGACGCCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 53}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948060963_948060965 4 Left 948060963 2:235043049-235043071 CCTGCTCATGGAGAACATCAGCA 0: 1
1: 1
2: 1
3: 15
4: 164
Right 948060965 2:235043076-235043098 GCGCTCCTTCGCTGACGCCCTGG 0: 1
1: 0
2: 0
3: 4
4: 53
948060962_948060965 5 Left 948060962 2:235043048-235043070 CCCTGCTCATGGAGAACATCAGC 0: 1
1: 0
2: 3
3: 13
4: 166
Right 948060965 2:235043076-235043098 GCGCTCCTTCGCTGACGCCCTGG 0: 1
1: 0
2: 0
3: 4
4: 53
948060959_948060965 17 Left 948060959 2:235043036-235043058 CCTCCGTGAGGACCCTGCTCATG 0: 1
1: 0
2: 0
3: 8
4: 100
Right 948060965 2:235043076-235043098 GCGCTCCTTCGCTGACGCCCTGG 0: 1
1: 0
2: 0
3: 4
4: 53
948060961_948060965 14 Left 948060961 2:235043039-235043061 CCGTGAGGACCCTGCTCATGGAG 0: 1
1: 0
2: 7
3: 61
4: 592
Right 948060965 2:235043076-235043098 GCGCTCCTTCGCTGACGCCCTGG 0: 1
1: 0
2: 0
3: 4
4: 53

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948060965 Original CRISPR GCGCTCCTTCGCTGACGCCC TGG Exonic
902325840 1:15700161-15700183 GAGCCCCATCGCTGAAGCCCTGG + Intronic
912576298 1:110675124-110675146 GGGCTCTTTCGCTGACACCGAGG - Intergenic
1071996469 10:91153913-91153935 GCGCACTCTCGCTGCCGCCCTGG + Intergenic
1075112667 10:119599981-119600003 TCTCTCCTTCCCTGATGCCCAGG - Intergenic
1075429523 10:122368907-122368929 GCGTGCCTTCCCTGACCCCCTGG - Intergenic
1084527014 11:69704004-69704026 GCGCTCCTGCTCTGACGGCGCGG + Exonic
1092201622 12:6587866-6587888 GCGCTCCTCCACTGACGCACGGG + Exonic
1102915730 12:116750378-116750400 GGGCTCCTCCTCTGAAGCCCAGG + Intronic
1110630090 13:77697816-77697838 CGGCTCCTTCCCTGTCGCCCCGG - Intergenic
1112058084 13:95709663-95709685 TCGCTCTGTCGCTGTCGCCCAGG + Intronic
1113473111 13:110561062-110561084 GCGTTCCTGCTCTGCCGCCCTGG - Intronic
1113806152 13:113110802-113110824 GTGCTCCTTCGAGGAGGCCCGGG + Exonic
1118971596 14:70642222-70642244 GGGCTCCTCCGCCGCCGCCCGGG - Exonic
1124233631 15:27968044-27968066 CTGCTCTTTCGCTGACGTCCTGG + Intronic
1127103368 15:55588646-55588668 GCGCTCCCTCGCCGACCGCCAGG + Intronic
1127975492 15:63994018-63994040 GCTCTCCTTGCCTGAAGCCCTGG - Intronic
1130348026 15:83066978-83067000 GCGCTCCTTCAGCGACGCCTTGG + Exonic
1132588347 16:715737-715759 GCGGCCCTTCGCGGGCGCCCAGG + Exonic
1142263909 16:89054833-89054855 GAGCTCCTCCGCCGAAGCCCTGG + Intergenic
1147951403 17:44109942-44109964 CCGCTCCTTCCCTCACTCCCAGG - Intronic
1149634667 17:58157090-58157112 GCGCTCCTCCGCGGCCGCCTCGG - Intergenic
1159931290 18:74315527-74315549 GAGCTCCGGCGCTGAAGCCCCGG - Intergenic
929212053 2:39367971-39367993 GCCCTCCTTCCCTGACTACCTGG - Intronic
934521408 2:95022431-95022453 CCCCTCCTGCGCTGACGCCATGG + Intergenic
937221692 2:120345966-120345988 GCGCCCCTTCCCTGCCGCGCGGG + Intergenic
937421134 2:121756126-121756148 ACGCTCATTCGCTGAAGACCAGG - Intronic
944457616 2:199911540-199911562 GCGCGCCGCCGCTGCCGCCCGGG - Exonic
948060965 2:235043076-235043098 GCGCTCCTTCGCTGACGCCCTGG + Exonic
1171333018 20:24357933-24357955 GCTCCCCTTCCCTGAGGCCCAGG + Intergenic
1175664778 20:60849291-60849313 GAGCTCTTTCTCTGACACCCTGG + Intergenic
1175731605 20:61358048-61358070 GCGCTCCTTCCCTGTCGCTCTGG + Intronic
1183650870 22:39152645-39152667 GCGCTCGCTCGCTGGCGCCGAGG - Exonic
1184536559 22:45091579-45091601 CCGCTCGCTCGCTGACGACCTGG + Intergenic
1185272692 22:49936086-49936108 GCGCTCCTCCCCCGCCGCCCCGG + Intergenic
968039747 3:195579068-195579090 GCGTTCCTGAGCTGTCGCCCTGG - Intronic
973551302 4:52038325-52038347 GCGCGCCTGCGCTTGCGCCCTGG + Exonic
975658822 4:76668101-76668123 GTGCTCCTTCGGTGAGGACCTGG + Intronic
996662883 5:126025719-126025741 TGGCTCCTTGGCTGATGCCCTGG - Intergenic
999244709 5:150147649-150147671 GCCCTCCTGCTCTGCCGCCCAGG - Intronic
1002058810 5:176614027-176614049 CAGCTCCTTGGCTGGCGCCCAGG + Intergenic
1003418914 6:5938438-5938460 GGGCTCCTCCGCTGAAGCCTGGG - Intergenic
1011672379 6:89695556-89695578 GGGCTCCTTCCCTGACGTGCTGG - Intronic
1013106125 6:107028121-107028143 TCGCTGCTTCGCTGCCGCCCTGG + Intergenic
1019340789 7:507875-507897 CCCCTCCTTCCCTGACCCCCCGG + Intronic
1019628969 7:2036342-2036364 GCGCTCCTGCGCTCATGCCTGGG - Intronic
1022101018 7:27169256-27169278 CTGCTCCTTCGCGGACGCCGGGG - Intronic
1034441026 7:151086265-151086287 GCGCTCCAGCCCTGGCGCCCCGG - Intronic
1036621100 8:10424903-10424925 CTGCTCCTTCGCTGTCCCCCGGG - Intronic
1037187947 8:16087684-16087706 TCGCTCTGTCGCTGTCGCCCAGG + Intergenic
1047812141 8:128422466-128422488 GTGCTCCTTCACTGATGCCAGGG - Intergenic
1049310998 8:141933799-141933821 TTGCTCCTTCCCTGACACCCTGG - Intergenic
1056170484 9:83980277-83980299 TCGCACCATCGCTGAAGCCCTGG - Intronic
1056617463 9:88180611-88180633 GCCCTCCTTCTCTCCCGCCCGGG + Intergenic
1059282801 9:113149271-113149293 GCACTCCTTCCCTGTCCCCCAGG - Intergenic
1060994838 9:127870052-127870074 TCCCTCCTTCGGTGAAGCCCTGG + Intronic
1061701461 9:132419395-132419417 GGGCTGCTTCTCTGACGCCACGG - Intronic
1062265801 9:135685948-135685970 GCGCTCCTTGGCTGGCTCCCTGG + Intergenic
1190242559 X:48668728-48668750 GGACTCCTTCCCTGACACCCTGG - Intergenic