ID: 948061111

View in Genome Browser
Species Human (GRCh38)
Location 2:235043893-235043915
Sequence GCTCTTCTTTGCAGGGTCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 199}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948061111_948061118 19 Left 948061111 2:235043893-235043915 CCAAGGACCCTGCAAAGAAGAGC 0: 1
1: 0
2: 3
3: 19
4: 199
Right 948061118 2:235043935-235043957 CCGAATCTGTGAGCTCCAAGAGG 0: 1
1: 0
2: 2
3: 6
4: 108
948061111_948061119 20 Left 948061111 2:235043893-235043915 CCAAGGACCCTGCAAAGAAGAGC 0: 1
1: 0
2: 3
3: 19
4: 199
Right 948061119 2:235043936-235043958 CGAATCTGTGAGCTCCAAGAGGG 0: 1
1: 0
2: 0
3: 25
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948061111 Original CRISPR GCTCTTCTTTGCAGGGTCCT TGG (reversed) Intronic