ID: 948061480

View in Genome Browser
Species Human (GRCh38)
Location 2:235045783-235045805
Sequence CCTCCCAGAGAGTCACAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 239}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948061473_948061480 0 Left 948061473 2:235045760-235045782 CCTCTGCCACCGCTTTACCTGCC 0: 1
1: 0
2: 3
3: 16
4: 244
Right 948061480 2:235045783-235045805 CCTCCCAGAGAGTCACAGCCAGG 0: 1
1: 0
2: 0
3: 26
4: 239
948061475_948061480 -9 Left 948061475 2:235045769-235045791 CCGCTTTACCTGCCCCTCCCAGA 0: 1
1: 0
2: 3
3: 48
4: 392
Right 948061480 2:235045783-235045805 CCTCCCAGAGAGTCACAGCCAGG 0: 1
1: 0
2: 0
3: 26
4: 239
948061472_948061480 15 Left 948061472 2:235045745-235045767 CCACGATTTCTGCGGCCTCTGCC 0: 1
1: 0
2: 0
3: 12
4: 171
Right 948061480 2:235045783-235045805 CCTCCCAGAGAGTCACAGCCAGG 0: 1
1: 0
2: 0
3: 26
4: 239
948061474_948061480 -6 Left 948061474 2:235045766-235045788 CCACCGCTTTACCTGCCCCTCCC 0: 1
1: 0
2: 0
3: 54
4: 683
Right 948061480 2:235045783-235045805 CCTCCCAGAGAGTCACAGCCAGG 0: 1
1: 0
2: 0
3: 26
4: 239

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948061480 Original CRISPR CCTCCCAGAGAGTCACAGCC AGG Intronic
900366986 1:2315373-2315395 CCTCCCGGAAGGTCCCAGCCTGG + Intergenic
900660181 1:3778216-3778238 CCTCCCAGAGACTCACGAACAGG + Intergenic
901027336 1:6285543-6285565 CCTCCCACTGGGTCAGAGCCTGG + Intronic
901455185 1:9359088-9359110 CCACTCAGAGCATCACAGCCGGG + Intronic
901530189 1:9848161-9848183 CTTCCCAGGGAGGCGCAGCCAGG - Intergenic
903439793 1:23379103-23379125 CCTTCCAGGAAGTCACAGCCTGG - Intergenic
903922056 1:26806671-26806693 CTTCCTAGAAAGTCACATCCAGG - Intergenic
904088630 1:27928958-27928980 CATCCCAGACAGACACAGCCAGG - Intergenic
909477165 1:76094059-76094081 CCTCCCTGACAGTCACTGCAGGG + Intronic
909609695 1:77539433-77539455 ACTCCCAGAGAGTCTCAGGGAGG + Intronic
911780102 1:101865677-101865699 AGCCCCAGAAAGTCACAGCCTGG + Intronic
915279703 1:154814060-154814082 CCTCCCAGAGAGTGGCAGGGAGG + Intronic
915595054 1:156892407-156892429 CTTCCCAGAGCCCCACAGCCGGG - Intergenic
917012347 1:170488611-170488633 CCTCTCACAGAGTCCCTGCCTGG + Intergenic
917541686 1:175920746-175920768 CCTCCCAGAGATTAACACACTGG + Intergenic
917622600 1:176812039-176812061 CCTACCAGGAAGTCACAGCACGG - Intronic
923436789 1:233975100-233975122 ATTCCCAGAGAGTCAGAGTCAGG + Intronic
1064870850 10:19935288-19935310 GCTGCAAGAGAGGCACAGCCAGG + Intronic
1067262444 10:44706214-44706236 GTTGCCAGAGTGTCACAGCCCGG + Intergenic
1068029323 10:51687689-51687711 CATTCCAGAGAGTCACAGCTTGG + Intronic
1069761419 10:70814230-70814252 CCTCCCAAAGACACACAGGCAGG - Intergenic
1070763799 10:79044917-79044939 CCTCCCAATGAGCCTCAGCCTGG + Intergenic
1070775302 10:79106332-79106354 TCTGCCTGAGAGTGACAGCCTGG + Intronic
1071277185 10:84066001-84066023 CAGGCCAGAGAGTCACAGCCAGG + Intergenic
1071524075 10:86348017-86348039 CTTCCCAGAGAGTCCCTTCCTGG - Intronic
1075615619 10:123889195-123889217 CATCTCAGAAAGTCACAGCCTGG - Intronic
1076734490 10:132452627-132452649 CCTCCCAGAGGTCCCCAGCCAGG - Intergenic
1077165007 11:1130952-1130974 CCACCCAGAGGGACACACCCAGG - Intergenic
1077232080 11:1462272-1462294 CCTCCCAGGCGGGCACAGCCCGG + Intronic
1078271372 11:9798205-9798227 CCTACTAGAGAGTCAAACCCAGG - Intronic
1078549247 11:12269100-12269122 TCCCCAAGGGAGTCACAGCCAGG - Intergenic
1079205066 11:18407646-18407668 TTTCCCAGTGAGTCACATCCTGG + Exonic
1079821486 11:25136177-25136199 CCTCCAGGAGAATCACCGCCAGG - Intergenic
1081854983 11:46297209-46297231 CCACCCAGCCAGCCACAGCCAGG - Intronic
1082027475 11:47583446-47583468 CTTCCCAGAGAGTCAGGGCAGGG - Intronic
1082761950 11:57136075-57136097 CCTACCTGAGAGTAACGGCCAGG + Intergenic
1083122464 11:60528370-60528392 CTTCCCAGAGAGTAATAGCTTGG + Intronic
1083587809 11:63873042-63873064 CCTGCCACAGAGTGCCAGCCCGG - Intronic
1083596778 11:63921341-63921363 CCTCCCAGAGAGGCTGAGCCTGG + Intergenic
1083664759 11:64268395-64268417 CTTCCCCCAGAGTCACAGGCAGG - Intronic
1088626523 11:111733935-111733957 CCTCCCAGAATGTCCCTGCCTGG - Intronic
1090626764 11:128615087-128615109 ACTCCCAGGGAGGCAGAGCCGGG + Intergenic
1090750326 11:129741091-129741113 CCTCCCAGAGCCTCTCACCCCGG - Intergenic
1091746851 12:2998361-2998383 CCTGCCAGAGATCCACAGCCCGG - Intronic
1092247929 12:6873571-6873593 CCTCGGGGAGGGTCACAGCCCGG - Intronic
1092527336 12:9317230-9317252 CCCCCAAGTGAGGCACAGCCCGG + Intergenic
1092539940 12:9414543-9414565 CCCCCAAGTGAGGCACAGCCCGG - Intergenic
1094404838 12:30106452-30106474 CCTCCTGGACAGTCACCGCCAGG + Intergenic
1096229854 12:49890776-49890798 CCTGCAACAGTGTCACAGCCTGG - Intronic
1096272476 12:50177144-50177166 CCTCCCAGAGTTCCACATCCTGG + Exonic
1096814178 12:54191308-54191330 CCGCCCAGTGAGTCACTCCCAGG + Intergenic
1096921768 12:55095061-55095083 TCTGCCTGAGAGTCACAGGCAGG + Intergenic
1098909230 12:76192241-76192263 TCTCCCAGAGAGTGACAACTTGG + Intergenic
1100565269 12:95789623-95789645 CCTCCCGCAGAGTCTCTGCCAGG + Intronic
1101359492 12:104012852-104012874 TCACACAGAGGGTCACAGCCAGG + Intronic
1101787745 12:107900480-107900502 CCTCCCAGAGAGCCACTCCAAGG + Intergenic
1102140911 12:110614161-110614183 TCTCCCAGGGAGTCCCAGCGAGG - Exonic
1103042543 12:117707802-117707824 CCTCCCAGACAGCCACACCTTGG - Intronic
1103889987 12:124231572-124231594 CCTCCCAGAGAGAAGCAGCGGGG + Intronic
1103900873 12:124303111-124303133 ACTCACAGGGAGGCACAGCCTGG - Intronic
1104960689 12:132487376-132487398 GCTCCCGGAGACACACAGCCCGG + Intergenic
1106247958 13:27964873-27964895 CCTCTCAGAGAGCCCCAGCGTGG + Exonic
1106473832 13:30080485-30080507 CCTCCCTGAGGCACACAGCCAGG - Intergenic
1110568355 13:76978680-76978702 CCTCCCAGGGAAACTCAGCCAGG + Intergenic
1114777095 14:25496524-25496546 CCTCCTTGACAGTCAAAGCCAGG + Intergenic
1117906108 14:60589245-60589267 CCTCCCAGAGAATAAGAGCATGG + Intergenic
1118374721 14:65166921-65166943 GCTCCAAGAAAGCCACAGCCAGG + Intergenic
1119261702 14:73241577-73241599 CCTCCCAGTGAGTCTCAGATGGG + Intronic
1119261843 14:73242310-73242332 CCTGCCATGGAGCCACAGCCTGG - Intronic
1121253061 14:92513827-92513849 CCTTCCAGAGGGCCAGAGCCAGG + Exonic
1122288284 14:100665793-100665815 CCTCACACAGAGTTGCAGCCTGG - Intergenic
1122537952 14:102479361-102479383 ACTCCCAGAGGTTCACTGCCAGG - Intronic
1123509179 15:20979041-20979063 CCTCCCAGAGTGTTACTGACTGG - Intergenic
1123566402 15:21552788-21552810 CCTCCCAGAGCGTTACTGACTGG - Intergenic
1123602664 15:21990074-21990096 CCTCCCAGAGTGTTACTGACTGG - Intergenic
1124341748 15:28894418-28894440 CCTCCTAGAGAGGCACAGTCTGG + Intronic
1124354567 15:28985147-28985169 TCTCCCAGCCAGTCAGAGCCTGG - Intronic
1124625275 15:31304181-31304203 CCCCCCAGCCAGGCACAGCCTGG + Intergenic
1124965429 15:34429549-34429571 CCTCCTAGAGAGGCACAGTCTGG - Intronic
1124982048 15:34575751-34575773 CCTCCTAGAGAGGCACAATCTGG - Intronic
1128160705 15:65421624-65421646 CTTTCCAGAGAGACTCAGCCAGG - Intronic
1130111408 15:80968418-80968440 CCTTGCTGAGAGTCACAGCTAGG - Intronic
1131545623 15:93313498-93313520 CTTCCCAGGGAGACAGAGCCTGG + Intergenic
1202974769 15_KI270727v1_random:279876-279898 CCTCCCAGAGTGTTACTGACTGG - Intergenic
1132595571 16:747715-747737 CTTCCCAGAGGGCCAGAGCCAGG + Intronic
1132996646 16:2827049-2827071 CTTCCCACAGAGGCTCAGCCTGG + Intergenic
1133495589 16:6314310-6314332 CCTTCCAGAAATTCACAGCCTGG + Intronic
1134022591 16:10931376-10931398 CATCCCCGACAGTCCCAGCCAGG + Exonic
1134588767 16:15434953-15434975 CCTCCCAGTGAGGCTCAGCCCGG - Intronic
1135814601 16:25621043-25621065 CCTACCCAAGAGGCACAGCCAGG - Intergenic
1138456984 16:57126728-57126750 CCTCCTAGAGAGGGGCAGCCAGG + Intronic
1138547035 16:57726060-57726082 CCTCCCAGAAAATCACAGAGCGG + Exonic
1138551568 16:57751631-57751653 CCTCCCTCAGGGGCACAGCCAGG + Exonic
1138572520 16:57884783-57884805 ACTCCCTCAGAGTCACTGCCTGG - Intronic
1139960873 16:70716605-70716627 AGTCCCAGAGAGTCTCAGTCAGG - Intronic
1140044539 16:71431909-71431931 AGTCCCAGAGAGTCACGGCCTGG + Intergenic
1141177521 16:81730623-81730645 CCTCACAGAGCCTCCCAGCCCGG - Intergenic
1141284925 16:82662774-82662796 CCTCCCAGAGGGACACATACTGG - Intronic
1142246027 16:88970437-88970459 CCTGGCAGAGATGCACAGCCTGG + Intronic
1143180843 17:4983077-4983099 CTTCACAGAGAGTCTCAGCCTGG + Intronic
1145976331 17:28986307-28986329 CCTCCCAGGGAGTCCCAGGCTGG - Intronic
1146568758 17:33935359-33935381 GCTCTCTGAGAGTCCCAGCCTGG - Intronic
1147923438 17:43932614-43932636 CGTCCCACAGGGTCTCAGCCAGG - Intergenic
1150168290 17:62965997-62966019 CATCCCAGAGCGCCAGAGCCAGG + Intergenic
1151978227 17:77494281-77494303 CCTCCCGGGGTGTCACCGCCAGG - Intronic
1152196555 17:78921859-78921881 CCTCCCAGAAATCCTCAGCCGGG + Intronic
1153818635 18:8813074-8813096 CCTGGCAGACAGTCACAGCCTGG + Exonic
1154213071 18:12396510-12396532 CCTGCCTGAGAGGCTCAGCCGGG + Intergenic
1155007317 18:21740968-21740990 CCCGCCACAGAGTCCCAGCCGGG - Intronic
1156460842 18:37320553-37320575 GTTCCCACAGAGGCACAGCCAGG - Intronic
1158513681 18:58113564-58113586 CCTGCCAGAGTGTCCCTGCCTGG - Intronic
1158911426 18:62066693-62066715 CCTCCCACAAGGTCACAGCAAGG - Intronic
1159324141 18:66893469-66893491 CCTCACAGAGATGCACAGACAGG + Intergenic
1160692049 19:464638-464660 CCTTCCAGAGCCCCACAGCCTGG + Intronic
1160717441 19:582693-582715 CCTCCCAGCGACCCACAGGCGGG - Intronic
1162777218 19:12987192-12987214 CCACCCACAGAGTGACAGCCAGG - Intergenic
1163368297 19:16888361-16888383 CCTCCCAGAGGGTAATAGCGAGG - Intergenic
1163753095 19:19090224-19090246 CCTTCTTGAAAGTCACAGCCAGG + Intronic
1164469514 19:28518365-28518387 CCTCTCAGAGAGGCACACCTGGG - Intergenic
1164649151 19:29879596-29879618 TCTCCCAGAGAGGCAGAGTCGGG + Intergenic
1164743370 19:30593552-30593574 TTTGCCAAAGAGTCACAGCCGGG - Intronic
1164889044 19:31807365-31807387 CACCCCAGAGGGACACAGCCTGG + Intergenic
1167736403 19:51297001-51297023 CCTTCCAGAATCTCACAGCCTGG + Intergenic
925072955 2:985516-985538 CCTCCCAGGGTGTCTCTGCCTGG - Intronic
925324497 2:3007385-3007407 CCTCCCAAAGAGTCTCAACTCGG + Intergenic
925845139 2:8027892-8027914 CAGCCCAGAGCGTGACAGCCCGG - Intergenic
926615661 2:14994584-14994606 GGTTCCCGAGAGTCACAGCCTGG + Intergenic
927488925 2:23507654-23507676 GCTCCCAGAGATGCACATCCTGG - Intronic
930948493 2:57106740-57106762 CATCCTAGAAAGTCACAGACAGG + Intergenic
931811084 2:65855851-65855873 TCACCCAGTGAGTCTCAGCCTGG + Intergenic
932579194 2:72982671-72982693 CCTCGCTGGGAGTCCCAGCCAGG - Intronic
932695292 2:73951224-73951246 CCAGCCAGAGAGTCACAGAATGG - Intronic
934613170 2:95755403-95755425 ACACCCAGAGAGACCCAGCCAGG - Intergenic
934647725 2:96069020-96069042 ACACCCAGAGAGACCCAGCCAGG + Intergenic
934841099 2:97624841-97624863 ACACCCAGAGAGACCCAGCCAGG + Intergenic
937854412 2:126661983-126662005 CCTCGCAGAGAGCCACTGCCAGG + Intronic
943180135 2:184530413-184530435 CCTCTCACAGAGCCAGAGCCTGG - Intergenic
947710065 2:232308372-232308394 CCTCCTTGACACTCACAGCCAGG + Intronic
948061480 2:235045783-235045805 CCTCCCAGAGAGTCACAGCCAGG + Intronic
948139142 2:235660055-235660077 CATCCCAGAGTGTGACTGCCTGG - Intronic
948701562 2:239763905-239763927 CCCGTCAGAGAATCACAGCCTGG + Intronic
1169075704 20:2758833-2758855 CAGCCCAGAGAGTGACAGGCAGG + Intronic
1169415323 20:5411313-5411335 CCTCCAAGAGACACACACCCTGG - Intergenic
1169501776 20:6167415-6167437 GCTCCCAGTGAGTGACAGCATGG + Intergenic
1170084131 20:12510276-12510298 ACACCCACAGAGTCACACCCAGG - Intergenic
1170465235 20:16616918-16616940 GCTCTGAGAAAGTCACAGCCAGG + Intergenic
1170817270 20:19724321-19724343 CCTTGCTGAGAGTCACTGCCAGG + Intergenic
1171091103 20:22286393-22286415 TCCCCCAGAGAAGCACAGCCTGG + Intergenic
1172384652 20:34525420-34525442 TGTCCCAGAGAGGCACACCCAGG + Intronic
1173959780 20:47062019-47062041 CCTCCCAGACAGTCCCATCGTGG - Intronic
1174415394 20:50363031-50363053 CTCCCCAGAGACACACAGCCAGG - Intergenic
1174527785 20:51187646-51187668 CCTCCCAGATTGTCACAAGCAGG - Intergenic
1174837403 20:53870752-53870774 GCCCTCAGCGAGTCACAGCCTGG - Intergenic
1175480369 20:59306388-59306410 CCTTCCAGAGGGTCACAGAGAGG - Intronic
1175745146 20:61451356-61451378 CCTACCTGAGATTCATAGCCAGG - Intronic
1176055928 20:63149070-63149092 CCTCCCGGGAAGTCACAGCCTGG + Intergenic
1178691230 21:34751899-34751921 CCTCTCAGGGAAACACAGCCTGG - Intergenic
1181806671 22:25378876-25378898 CCACACAGCGAGTCACAGCCAGG - Intronic
1182752724 22:32654551-32654573 CCTCCAAGAGTGACCCAGCCAGG - Intronic
1183697253 22:39430439-39430461 CCTCCCAGATGGCCTCAGCCAGG + Exonic
1184033709 22:41909026-41909048 CCTCCCGGAGGGACACTGCCAGG + Intergenic
1184334666 22:43846072-43846094 CCTCCCACAGAGTCAACGCAAGG + Intronic
1184350864 22:43943366-43943388 GCTCCCAGACAGTGACAGGCAGG + Intronic
1184372247 22:44089984-44090006 GCTCCAAGAGAGACACAGACTGG - Intronic
1184873986 22:47260978-47261000 CAGCCCAGTGTGTCACAGCCAGG + Intergenic
949414665 3:3800957-3800979 CCGCCCAGGGAGTCCCTGCCTGG + Intronic
950696355 3:14703979-14704001 CCTTCCAGAGTGTCACAGTGAGG - Intronic
952956708 3:38562242-38562264 CCTCCAGGAGAGGCACAGCTGGG - Intronic
953051561 3:39349024-39349046 CCTCCCAGAGATTCCCCTCCTGG + Intergenic
953738054 3:45513267-45513289 ACTCCCAGAGAGCCAAGGCCAGG + Intronic
954409115 3:50362224-50362246 CCTCCCAGAGCCTGAAAGCCAGG - Intronic
954446381 3:50549131-50549153 CCTCCCTCCCAGTCACAGCCAGG + Intergenic
955084665 3:55691048-55691070 CCTCACAGAGAGCCACTGCAGGG + Intronic
955341499 3:58128907-58128929 CCTCCCAGAGAGCCAAATGCCGG + Intronic
959546144 3:107598970-107598992 CCTCCCCCAGGGTCACTGCCTGG - Intronic
961637517 3:128342621-128342643 CCGCCCAGCAAGGCACAGCCAGG - Intronic
961654734 3:128435091-128435113 GCTGCCAGGGAGTCACAGCCAGG - Intergenic
962251476 3:133838591-133838613 CCACCCAGAGTGGCACTGCCTGG - Intronic
964476890 3:157105566-157105588 CCGGCCAGAGAGACACAGTCAGG + Intergenic
967107756 3:186268094-186268116 CCTCCCAGAGTCTCAGGGCCTGG - Intronic
967207884 3:187139851-187139873 CCTCCCATCGAGCCACCGCCGGG + Intronic
967481529 3:189978949-189978971 GCAACCAGAGAGTCAGAGCCAGG - Intronic
969576463 4:8038895-8038917 GCTCCCAGTCACTCACAGCCTGG + Intronic
969721673 4:8895665-8895687 CCACCCAGAGTCCCACAGCCAGG + Intergenic
972475728 4:39447309-39447331 CCCCCCAGGGAATCACAGCCAGG - Exonic
973611052 4:52636309-52636331 CCTCCCAGAAGAACACAGCCTGG + Intronic
976069230 4:81222266-81222288 CCTCCCAGAGATGCATACCCAGG - Intergenic
976069246 4:81222375-81222397 CCTCCCAGAGATGCATACCCAGG - Intergenic
978852568 4:113356008-113356030 CTTTCCAGAGAGTCACGGCAAGG - Exonic
978949849 4:114544944-114544966 CATCCCTGAGACTCAGAGCCCGG - Intergenic
979853842 4:125607389-125607411 CCTCCCAGAGAGTTATGGGCAGG + Intergenic
981039968 4:140213932-140213954 ACCCCCAGTGAGTCACACCCTGG - Intergenic
983910834 4:173236770-173236792 CCTCTAAGGGAGTCACAGCCTGG - Intronic
985373867 4:189314034-189314056 CCTCCCAGACAGTCTCCACCAGG - Intergenic
985674948 5:1226119-1226141 TCTCCCAGAGAACCAAAGCCAGG - Intronic
990341999 5:54832989-54833011 CCTCGCAGAGATGCTCAGCCCGG + Intergenic
990365186 5:55063340-55063362 TCTCCAAGTGAGTCAGAGCCTGG - Intergenic
990818794 5:59814502-59814524 CCTGCCAGTGAGTCACATGCAGG + Intronic
993006677 5:82435505-82435527 GCTCACAGCGAGTCACAGCAAGG - Intergenic
994789501 5:104205957-104205979 AATCCCAGACAGTCACAGCAGGG + Intergenic
999317310 5:150592666-150592688 CCTCCCATTGAGCCATAGCCTGG + Intergenic
999442490 5:151613345-151613367 CCACCCACACAGTCTCAGCCTGG + Intergenic
1001496978 5:172195571-172195593 CATCCCAGAGAGACTCAGCATGG - Intronic
1001538058 5:172513617-172513639 CCTCCGTGAGAGTCAGTGCCAGG + Intergenic
1001932669 5:175684288-175684310 CCCCCCAGGGAGCCACAGACAGG + Exonic
1002271446 5:178075313-178075335 CCTGCCACAGCATCACAGCCTGG - Intergenic
1002425149 5:179170577-179170599 GCTCACAGAGAAGCACAGCCAGG - Intronic
1004001643 6:11601960-11601982 CTTCCAAGAGACTCACAGCTGGG + Intergenic
1005989056 6:30892087-30892109 CATCCCACATAGTCATAGCCTGG - Exonic
1006481217 6:34296009-34296031 CCTCCCAGAGTGGCAGTGCCTGG - Intronic
1006794207 6:36721743-36721765 CCTCCCAGCGGGGCTCAGCCTGG + Exonic
1006794368 6:36722370-36722392 CCTCCCAGGGGGGCTCAGCCTGG + Exonic
1008189612 6:48438815-48438837 CCTCACAGAGAGTCTCTGCTAGG + Intergenic
1011018167 6:82781868-82781890 CATCACAGAGAGTCCCAGCTAGG + Intergenic
1011287455 6:85740160-85740182 CCTAACAGAGAAACACAGCCAGG - Intergenic
1017424392 6:154305636-154305658 TCTCCCTGACAGTCACACCCAGG - Intronic
1018798785 6:167207150-167207172 CCTTCCAGTCAGTGACAGCCAGG - Intergenic
1019994541 7:4715652-4715674 CCTGCCAGTCAGTCACAGCAGGG - Intronic
1021845359 7:24757627-24757649 GCTCCCAGAGAGTCACACGAAGG - Intronic
1021908873 7:25364390-25364412 CCTCCAACAGAGTCAAAGCTTGG + Intergenic
1022517352 7:30984375-30984397 CATCCCAGAGAGTCTGAGCCCGG - Intronic
1023868063 7:44248253-44248275 CCTCCCAGCCAGTCATGGCCTGG - Intronic
1027245629 7:76365349-76365371 CCTCCCAAAGAGTTAGAGCTGGG + Intergenic
1027251047 7:76398912-76398934 CCACACAAAGAGTCACAGCCAGG + Intronic
1029180008 7:98693570-98693592 AGTCTCAGAGAGACACAGCCAGG - Intergenic
1031008370 7:116499522-116499544 CGTCCCCACGAGTCACAGCCCGG - Exonic
1032649167 7:133858494-133858516 TCTCCCGGAGACTGACAGCCTGG + Intronic
1035188434 7:157143959-157143981 CCTCCCTGAGATTCACTCCCTGG - Intronic
1035222221 7:157412807-157412829 CCACTCACAGGGTCACAGCCAGG + Intronic
1035288016 7:157818642-157818664 CATCCCAGGGACTCACACCCAGG - Intronic
1035371506 7:158382092-158382114 GCACCCTGAGAGCCACAGCCAGG + Intronic
1035663453 8:1363919-1363941 CCTCCCTGACAGTGACAGCCAGG + Intergenic
1036220794 8:6920526-6920548 CCTCCTAGGGAGTCCCATCCCGG - Intergenic
1036760710 8:11506829-11506851 CCTCCCTGAGAGTCCCACCTGGG - Intronic
1037486165 8:19348924-19348946 CCTCCCAGAGACTCACAATATGG - Intronic
1041395335 8:57384447-57384469 CCTCCCTGAGGCTCACAGCCTGG - Intergenic
1044264006 8:90161519-90161541 CCTCTCTGAGCCTCACAGCCTGG - Intergenic
1044841138 8:96338132-96338154 CATCCCAGGGCGTCAGAGCCTGG + Intergenic
1045322531 8:101092596-101092618 CCTTCCTGTGATTCACAGCCAGG - Intergenic
1048847566 8:138615149-138615171 TCACCCAGAGAGTCAGAGGCAGG - Intronic
1049033949 8:140060283-140060305 AATCCCAGAGCCTCACAGCCAGG - Intronic
1049368165 8:142250880-142250902 CCTCTCCGAGAGGCACAGGCAGG - Intronic
1049663785 8:143833458-143833480 CCTCCCAGAGGATGCCAGCCAGG + Intergenic
1049697686 8:143991596-143991618 CCTTCCTGAGACTCACAGTCAGG - Exonic
1051344088 9:16136993-16137015 GCTCCTAGGGTGTCACAGCCAGG - Intergenic
1051838540 9:21367911-21367933 TCTCCCTGAGACCCACAGCCTGG - Exonic
1051844878 9:21440582-21440604 TCTCCCTGAGACCCACAGCCTGG + Exonic
1051845232 9:21444566-21444588 CCTCTCAGGGAATCACAACCTGG + Intergenic
1052369271 9:27645667-27645689 CCCCCTAGGGAGTCAGAGCCAGG - Intergenic
1056821050 9:89842388-89842410 CCTCTCAGAGTGTGACAGTCAGG + Intergenic
1057283492 9:93729200-93729222 CCACCCTGAGATACACAGCCCGG + Intergenic
1058423557 9:104856537-104856559 CCTCCCAGAGAGATACTGTCAGG + Intronic
1059432683 9:114259575-114259597 ACTCCCAGAGAGGCACAGAAAGG + Intronic
1060918682 9:127405751-127405773 ACTCCCAAGGGGTCACAGCCTGG - Intronic
1062208348 9:135349395-135349417 CAGCCCGGAGAGCCACAGCCCGG - Intergenic
1062398225 9:136361155-136361177 CCTCCCAGCGGGACACGGCCAGG - Intronic
1062647597 9:137556846-137556868 GCCCTCAGAGAGCCACAGCCTGG + Intronic
1187831408 X:23385575-23385597 ACTCTCAGAAAGTCACAGCTGGG + Intronic
1189282035 X:39825765-39825787 CAGCTCAGAGAGTCTCAGCCAGG - Intergenic
1189739315 X:44102141-44102163 TCTCCCAGAGTTTCACAACCAGG + Intergenic
1192552971 X:72068764-72068786 CAGCCCAGAGATTCACAGACTGG - Intergenic
1194689354 X:96963643-96963665 GCTCCCAGCTAATCACAGCCAGG + Intronic
1195857124 X:109343500-109343522 CCTCCCACAGAGCCAATGCCTGG - Intergenic
1199594699 X:149497324-149497346 CCTTTCAAAGAATCACAGCCAGG + Intronic
1200152456 X:153957941-153957963 GCTCCAGGAGAGTCTCAGCCAGG - Intronic
1200918681 Y:8593725-8593747 CCTCCAACAGAAACACAGCCTGG - Intergenic