ID: 948062796

View in Genome Browser
Species Human (GRCh38)
Location 2:235053886-235053908
Sequence GCGGAGCTGAAGAGGGAGGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1350
Summary {0: 1, 1: 0, 2: 6, 3: 113, 4: 1230}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948062785_948062796 9 Left 948062785 2:235053854-235053876 CCCTCTTCTGCCCTGCGTGCCCT 0: 1
1: 0
2: 1
3: 46
4: 347
Right 948062796 2:235053886-235053908 GCGGAGCTGAAGAGGGAGGAAGG 0: 1
1: 0
2: 6
3: 113
4: 1230
948062784_948062796 30 Left 948062784 2:235053833-235053855 CCTGCTGCTCTGGAGTGCAAGCC 0: 1
1: 0
2: 2
3: 22
4: 315
Right 948062796 2:235053886-235053908 GCGGAGCTGAAGAGGGAGGAAGG 0: 1
1: 0
2: 6
3: 113
4: 1230
948062787_948062796 -1 Left 948062787 2:235053864-235053886 CCCTGCGTGCCCTGCTGTCACCG 0: 1
1: 0
2: 0
3: 19
4: 122
Right 948062796 2:235053886-235053908 GCGGAGCTGAAGAGGGAGGAAGG 0: 1
1: 0
2: 6
3: 113
4: 1230
948062786_948062796 8 Left 948062786 2:235053855-235053877 CCTCTTCTGCCCTGCGTGCCCTG 0: 1
1: 0
2: 1
3: 41
4: 374
Right 948062796 2:235053886-235053908 GCGGAGCTGAAGAGGGAGGAAGG 0: 1
1: 0
2: 6
3: 113
4: 1230
948062790_948062796 -10 Left 948062790 2:235053873-235053895 CCCTGCTGTCACCGCGGAGCTGA 0: 1
1: 0
2: 1
3: 9
4: 72
Right 948062796 2:235053886-235053908 GCGGAGCTGAAGAGGGAGGAAGG 0: 1
1: 0
2: 6
3: 113
4: 1230
948062788_948062796 -2 Left 948062788 2:235053865-235053887 CCTGCGTGCCCTGCTGTCACCGC 0: 1
1: 0
2: 0
3: 24
4: 193
Right 948062796 2:235053886-235053908 GCGGAGCTGAAGAGGGAGGAAGG 0: 1
1: 0
2: 6
3: 113
4: 1230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948062796 Original CRISPR GCGGAGCTGAAGAGGGAGGA AGG Exonic
900391497 1:2435937-2435959 GAGGAGGAGAGGAGGGAGGAAGG - Intronic
900391596 1:2436236-2436258 GAGGAGGGGAGGAGGGAGGAAGG - Intronic
900391678 1:2436470-2436492 GAGGAGGGGAGGAGGGAGGAAGG - Intronic
900400440 1:2470841-2470863 GAGGAGCTGCAGAGGGAGCCAGG - Intronic
900726601 1:4220419-4220441 CCGGAGCTGGGGAGGCAGGAAGG - Intergenic
900829008 1:4950683-4950705 GAGGGGCTGCAGGGGGAGGATGG + Intergenic
901009568 1:6192152-6192174 GGGGAGCTGAAGTGGGAGGATGG - Intronic
901120090 1:6884179-6884201 GCAAGGCTGAAGAGGAAGGAGGG + Intronic
901160439 1:7173100-7173122 GCGCAGCTGAAGAGACAGGAGGG - Intronic
901179150 1:7328388-7328410 GGGAGGCTGAAGTGGGAGGATGG + Intronic
901325210 1:8361241-8361263 GAGGAGCTGAGGAGGGAGCTGGG + Exonic
901373601 1:8821132-8821154 GGGAAGCTGAGGTGGGAGGATGG + Intergenic
901496710 1:9626507-9626529 GCAGAGCTGGGCAGGGAGGAAGG + Intergenic
901538682 1:9900618-9900640 GCAGACCTCAGGAGGGAGGAAGG + Intronic
901608965 1:10481924-10481946 GGGGAGCTGAGGTAGGAGGATGG - Intronic
901916024 1:12500947-12500969 GGGAAGCTGAGGTGGGAGGATGG + Intronic
902090301 1:13897845-13897867 AAGGACCTGGAGAGGGAGGAAGG - Intergenic
902298866 1:15487242-15487264 AGGGAGTTGAAGTGGGAGGAAGG - Intronic
902328287 1:15717011-15717033 GGGAGGCTGAGGAGGGAGGATGG + Intronic
902371763 1:16012152-16012174 GGGAGGCTGAAGTGGGAGGATGG - Intergenic
902691538 1:18112937-18112959 AAGGAGGTGGAGAGGGAGGATGG - Intronic
902861622 1:19251111-19251133 TCGAACCTGACGAGGGAGGACGG + Intronic
902918294 1:19651797-19651819 GGGAAGCTGAGGCGGGAGGATGG - Intronic
902926245 1:19697701-19697723 GGGAAGCTGAGGTGGGAGGATGG - Intronic
903049182 1:20588390-20588412 GGGAAGCTGAGGTGGGAGGATGG - Intergenic
903186141 1:21630371-21630393 GGGAGGCTGAGGAGGGAGGATGG - Intronic
903356671 1:22752390-22752412 GGGAAGCTGAGGTGGGAGGATGG + Intronic
903384884 1:22919695-22919717 AGGGAGCAGGAGAGGGAGGAGGG + Intergenic
903573955 1:24326326-24326348 GTGGAGGGGAAGAGGGAGAATGG - Intronic
903631334 1:24774684-24774706 GCGAGGCTGAGGTGGGAGGATGG + Intronic
903646109 1:24897358-24897380 CCGGGGCTGAGGAGGGAGGCAGG + Intergenic
903754780 1:25653181-25653203 GAGAAGCTGAGGTGGGAGGATGG - Intronic
904037474 1:27566657-27566679 GCAGAGGTGAGGAGGGAGGGGGG + Intronic
904037518 1:27566830-27566852 GCAGAGCTGTCGAGGGAGGGGGG + Intronic
904315595 1:29658365-29658387 GCTGAGCAGACGATGGAGGAGGG - Intergenic
904477765 1:30775829-30775851 GCTGAACTGAGGAGGGAGGGAGG + Intergenic
904541537 1:31237011-31237033 GGGAGGCTGAAGTGGGAGGATGG + Intronic
904632242 1:31851221-31851243 GGGAAGCTGAGGTGGGAGGATGG - Intergenic
904773488 1:32893687-32893709 GCGGAGCGGGAAAGGGAGGCAGG - Intronic
906570846 1:46837745-46837767 GGGAGGCTGAAGTGGGAGGATGG - Intergenic
906645296 1:47470349-47470371 GCGGGGCGTAAGAGAGAGGAAGG + Intergenic
906694109 1:47812486-47812508 GCGGGGCTGAGGCAGGAGGATGG + Intronic
906967280 1:50470594-50470616 GAGAAGCAGAAGAGGTAGGAAGG - Intronic
907052708 1:51340506-51340528 GGGGCGGTGATGAGGGAGGAGGG - Intronic
907361654 1:53921066-53921088 GGGAAGCTGAGGTGGGAGGATGG + Intronic
907594058 1:55703641-55703663 GAGGAGTGGAAGAGAGAGGAAGG + Intergenic
907933410 1:59020579-59020601 CCAGAGCTGTAGAGGGAGAAGGG - Intergenic
908780905 1:67688781-67688803 GCGGGGCTGAAAAGGAAGGTGGG + Intergenic
909431834 1:75597081-75597103 GGGAGGCTGAAGTGGGAGGATGG + Intronic
909669197 1:78169044-78169066 GGGAGGCTGAAGTGGGAGGATGG - Intergenic
909690393 1:78399933-78399955 GGGAGGCTGAAGTGGGAGGATGG + Intronic
910160283 1:84265024-84265046 GTGGAGATGAGGAGGAAGGATGG + Intergenic
910263165 1:85311550-85311572 GGGGGGCTGAGGTGGGAGGATGG - Intergenic
910285184 1:85545775-85545797 GAGGAGATGCAGAGGGAGGAGGG + Intronic
910554604 1:88517477-88517499 GAGGAGGAGAAGAGGAAGGAAGG + Intergenic
910876722 1:91885576-91885598 GCGGAGAGGAAGAGTGAGGGCGG + Intronic
911271419 1:95806289-95806311 GCAGAGCAGAAGAGGTAGGTAGG - Intergenic
911647697 1:100353188-100353210 AGGGAGCTGCAGAGGGAGCAAGG - Intronic
911995696 1:104763182-104763204 GCGGGTTAGAAGAGGGAGGAAGG - Intergenic
912138825 1:106696381-106696403 GGGGAGCCTAGGAGGGAGGAAGG - Intergenic
912398401 1:109367120-109367142 GGGAGGCTGAAGTGGGAGGATGG + Intronic
912643484 1:111369402-111369424 GCACAGCTGTAGAGGAAGGACGG + Intergenic
912696721 1:111847744-111847766 CAGCAGCTGGAGAGGGAGGATGG + Intronic
912875584 1:113355359-113355381 GGGAGGCTGAGGAGGGAGGATGG - Intergenic
913163891 1:116168186-116168208 GAGAAGCTAAGGAGGGAGGATGG + Intergenic
913165592 1:116181782-116181804 GCGGAGCTCAGGAGGATGGAGGG - Intergenic
913458209 1:119055724-119055746 GAGGAGGAGAAGAGGGAGGGAGG + Intronic
913468350 1:119165964-119165986 GGGAAGCTGAGGTGGGAGGATGG + Intergenic
913534108 1:119755119-119755141 GGGAGGCTGAAGTGGGAGGATGG - Intronic
913714630 1:121520902-121520924 GGGGTGCTGAGGTGGGAGGATGG + Intergenic
914676532 1:149910768-149910790 GCACAGAAGAAGAGGGAGGAGGG + Intronic
914784742 1:150818056-150818078 GAGGGGGTGGAGAGGGAGGAAGG + Intronic
914861240 1:151388001-151388023 GGGAGGCTGAAGTGGGAGGATGG + Intergenic
915217495 1:154349805-154349827 GAGGAGCTGACCAGGGAGGGAGG + Exonic
915240738 1:154519788-154519810 GCGGAGCAGGATGGGGAGGAGGG + Intronic
915398491 1:155604768-155604790 GGGGGGCTGAGGTGGGAGGATGG + Intergenic
915415963 1:155743201-155743223 CGGGAGCTGAGGTGGGAGGATGG + Intergenic
915513396 1:156399538-156399560 GCGGAGCTGAAGGGCCAGGAGGG - Intergenic
915728814 1:158038101-158038123 GCCTGGCTGATGAGGGAGGAAGG + Intronic
915965380 1:160302931-160302953 GGGAAGCTGATGTGGGAGGATGG + Intronic
915981679 1:160424308-160424330 GAGGAGCTGGGGAAGGAGGAAGG - Intronic
916249743 1:162725481-162725503 GGGGAGCTGAGGCAGGAGGATGG - Intronic
916412333 1:164559013-164559035 GGGGAGAGGAGGAGGGAGGAGGG - Intronic
916488251 1:165278574-165278596 CTGCAGGTGAAGAGGGAGGATGG - Intronic
917322387 1:173796792-173796814 GGGAGGCTGAGGAGGGAGGATGG + Intergenic
917413964 1:174788951-174788973 GGGTGGCTGAAGAGAGAGGATGG - Intronic
917526746 1:175795066-175795088 GTGTAGATGAAGAGGAAGGAAGG + Intergenic
917753942 1:178080549-178080571 GGGAAGCTGAGGTGGGAGGATGG - Intergenic
917812952 1:178677993-178678015 GGGAAGCTGAGGTGGGAGGATGG + Intergenic
917825880 1:178819793-178819815 GTGGAGTTGAAGAGGGGGAATGG - Intronic
917947825 1:179994556-179994578 GGGAAGCTGAGGTGGGAGGATGG - Intronic
918266205 1:182844444-182844466 GAAGAGCTGAAGTGGGAGGATGG - Intronic
919055572 1:192565762-192565784 GAGGAGGTGGAGAGGGAGGAAGG + Intergenic
919956297 1:202420286-202420308 GGGGAGGAGAAGAGGGAGTATGG + Intronic
920001008 1:202798780-202798802 GGGAAGCTGAGGTGGGAGGATGG + Intronic
920094248 1:203475703-203475725 GGGGAGGAGAGGAGGGAGGAGGG - Intergenic
920374278 1:205498993-205499015 GATGAGCTGACGAGGGAGGCAGG + Intergenic
920920871 1:210296250-210296272 GGGAGGCTGAAGTGGGAGGATGG + Intergenic
920974325 1:210771398-210771420 CAGGAGCTGAAGAGGCAGCAAGG + Intronic
921023846 1:211259763-211259785 GGGGAGGGGAAGAGGGAGGGGGG - Intronic
921305395 1:213791585-213791607 TGGGAGGTAAAGAGGGAGGAAGG + Intergenic
921560505 1:216652872-216652894 GGGGAGCCGAACAGGGTGGAAGG - Intronic
921610783 1:217209908-217209930 GGGAGGCTGAAGTGGGAGGATGG - Intergenic
922072050 1:222204291-222204313 GAGGAGCAGTAGAGGGAGAAAGG + Intergenic
922124779 1:222711984-222712006 GCGGAGGCGGAGAGGGAAGAAGG + Intronic
922129103 1:222759134-222759156 GGGAAGCTGAGGTGGGAGGATGG - Intergenic
922213268 1:223501218-223501240 GAGGAGGAGGAGAGGGAGGAGGG - Intergenic
922239646 1:223747304-223747326 GCGGACCTTCAGAGGGTGGAGGG - Intronic
922317594 1:224456513-224456535 GGGAAGCTGAGGTGGGAGGATGG - Intronic
922322443 1:224500566-224500588 GGGAGGCTGAGGAGGGAGGATGG + Intronic
922427947 1:225517301-225517323 GGGCAGCTGCAGAGGGAGAAGGG + Exonic
922507294 1:226133927-226133949 GCGCTGATGAGGAGGGAGGATGG + Intergenic
922511953 1:226176104-226176126 GTGGCTCTGAAGATGGAGGAAGG + Intronic
922780499 1:228248933-228248955 GGGAAGCTGAGGTGGGAGGATGG + Intronic
922784442 1:228276114-228276136 GCTGAGGGGAGGAGGGAGGAGGG + Intronic
922784460 1:228276181-228276203 GCTGAGGGGAAGAGAGAGGAGGG + Intronic
923026665 1:230209736-230209758 GGGAGGCTGAAGTGGGAGGATGG + Intronic
923072368 1:230577640-230577662 GAGGAGAAGAAGAAGGAGGAAGG - Intergenic
923384471 1:233452996-233453018 GGGGAGATGGAGAGGGGGGAGGG - Intergenic
923469471 1:234277952-234277974 GGGAAGCTGAGGAGGGAAGATGG + Intronic
923562515 1:235051980-235052002 GGGCAGCTGAGGTGGGAGGATGG + Intergenic
924019289 1:239763984-239764006 CAGGAGCTGAGGTGGGAGGATGG + Intronic
924049951 1:240070668-240070690 GCAGGGCTGAACAGGAAGGACGG + Intronic
924536654 1:244940982-244941004 GCGAGGCTGAGGTGGGAGGAAGG + Intergenic
924594083 1:245430149-245430171 TGGGGGCTGAAGAGGGAGGATGG + Intronic
924951841 1:248891717-248891739 GGGAAGCTGAAGCGGGAAGATGG + Intergenic
1062766481 10:69790-69812 GGGAGGCTGAAGCGGGAGGATGG + Intergenic
1062838658 10:652537-652559 ACGGAGCTGCAGTGGGAGGCGGG + Exonic
1063373859 10:5540133-5540155 TGGGAGCTGAGGTGGGAGGATGG - Intergenic
1064137204 10:12761415-12761437 GCGGAACTGCACCGGGAGGAGGG - Intronic
1064265368 10:13821246-13821268 GCTGTGCTGGAGAGGCAGGAAGG - Intronic
1064543100 10:16424959-16424981 GCGGGGCTGAGACGGGAGGATGG - Intergenic
1064613406 10:17127368-17127390 GGGAGGCTGAAGTGGGAGGATGG - Intronic
1064629968 10:17300133-17300155 GAGAGGCTGAGGAGGGAGGATGG + Intergenic
1064654302 10:17541677-17541699 GGGCAGCTGAGGTGGGAGGATGG - Intergenic
1064906839 10:20356383-20356405 GGGGAGCTGAGGTGGGAGGATGG - Intergenic
1064943427 10:20760437-20760459 GGGGAGTTGAAGAGGGAGTTGGG - Intergenic
1065525846 10:26620355-26620377 GGGAGGCTGAAGTGGGAGGATGG - Intergenic
1065540705 10:26763925-26763947 GTGGAGCTCCAGAAGGAGGAGGG + Exonic
1065670254 10:28108550-28108572 GCGAGGCTGAGGTGGGAGGATGG + Intronic
1065815401 10:29478679-29478701 GGGAGGCTGAAGTGGGAGGATGG + Intronic
1065876762 10:30003962-30003984 GGGAAGCTGAGGTGGGAGGATGG - Intergenic
1065960398 10:30729577-30729599 GAGAGGCTGAGGAGGGAGGATGG - Intergenic
1066047445 10:31605509-31605531 AAGGAGCTGAGGTGGGAGGAAGG - Intergenic
1067337898 10:45379279-45379301 GAGGGGCTGGAGAGGGAGGAAGG - Intronic
1068236995 10:54250014-54250036 CTGGTGCTGAAGTGGGAGGATGG - Intronic
1069374385 10:67779243-67779265 GGGAGGCTGAAGGGGGAGGATGG + Intergenic
1070021989 10:72595888-72595910 GGGAAGCTGAGGAGGAAGGATGG + Intronic
1070260772 10:74853396-74853418 GGGGGGCTGAGGTGGGAGGATGG - Intronic
1070269376 10:74938048-74938070 GGGAGGCTGAGGAGGGAGGATGG - Intronic
1070271109 10:74956026-74956048 GGGGAGTTGAGGTGGGAGGACGG - Intronic
1070609488 10:77923651-77923673 GCGGGGCTGAGGCAGGAGGATGG + Intronic
1070673699 10:78397322-78397344 GAGGAGCTGAAGAGTTAGGCAGG + Intergenic
1070739906 10:78895892-78895914 GCGGAGATGGAGGCGGAGGAAGG - Intergenic
1070809455 10:79290336-79290358 GAGGAGTGGAAGAGAGAGGAAGG - Intronic
1070972350 10:80578073-80578095 GGGGGGCTGAAGTGGGACGATGG - Intronic
1071497555 10:86179296-86179318 AGGGAGGGGAAGAGGGAGGAGGG - Intronic
1071967655 10:90868618-90868640 GGGGAGATGAACAGGGAAGAGGG - Intergenic
1072613269 10:97033151-97033173 GGGGGGCTGAGGTGGGAGGATGG - Intronic
1072687541 10:97547388-97547410 CTGGGGCAGAAGAGGGAGGATGG - Intronic
1072792948 10:98332014-98332036 GAGGAGCAGGAGAGAGAGGAGGG - Intergenic
1073141388 10:101250634-101250656 CCGGGGCTGAGGTGGGAGGAGGG - Intergenic
1073232422 10:101983384-101983406 GGGAGGCTGAGGAGGGAGGATGG - Intronic
1073247210 10:102099576-102099598 GAGAAGCCGAGGAGGGAGGATGG + Intergenic
1073357391 10:102868199-102868221 GGGAGGCTGAGGAGGGAGGATGG + Intronic
1073394021 10:103203457-103203479 GGGAGGCTGAGGAGGGAGGATGG - Intergenic
1073485995 10:103819559-103819581 TGGGGGCAGAAGAGGGAGGAGGG + Intronic
1073486394 10:103821655-103821677 GGGGAGCTGAGGCAGGAGGATGG - Intronic
1073559803 10:104487078-104487100 GCAGAGCTGGAGAGGGAGCCTGG + Intergenic
1073854273 10:107656729-107656751 GCTGAACTGAAGAGGGTGGTTGG - Intergenic
1073871282 10:107867796-107867818 GCGGAGCCCAAGAGAGGGGAGGG + Intergenic
1074182378 10:111076521-111076543 GGGGTCCTGGAGAGGGAGGAAGG - Intergenic
1074894338 10:117762008-117762030 GCGGGGGTGAAGAGTGAGGAGGG + Intergenic
1074967119 10:118501183-118501205 GCAGAGCAGATGAGGCAGGAAGG - Intergenic
1075167491 10:120082208-120082230 GGGAAGCTGAGGAGGGAGAATGG - Intergenic
1075318897 10:121473596-121473618 GGGAAGCTGAGGTGGGAGGATGG + Intergenic
1075805791 10:125187926-125187948 GTGGGGCTAAAGAGGGAGGAGGG - Intergenic
1076413399 10:130267537-130267559 GAGGACCTGAAGGTGGAGGAAGG - Intergenic
1076581803 10:131517018-131517040 TCGGGGCTGAAGAGGGTGGTGGG - Intergenic
1076939261 10:133590750-133590772 GTGGAGCAGAAGATGCAGGAAGG - Intergenic
1077115370 11:881897-881919 GCGAGGCTGAGGTGGGAGGATGG + Intronic
1077116312 11:886352-886374 GGGGGGCTGAGGTGGGAGGATGG + Intronic
1077140468 11:1022059-1022081 GCGGGGCTGCAGAGGGCAGAGGG - Intronic
1077140476 11:1022096-1022118 GCGGGGCTGCAGAGGGCAGAGGG - Intronic
1077140493 11:1022165-1022187 GCGGGGCTGTAGAGGGCAGAGGG - Intronic
1077140520 11:1022274-1022296 GCGGGGCTGTAGAGGGCAGAAGG - Intronic
1077140529 11:1022311-1022333 GCGGGGCTGTAGAGGGCAGATGG - Intronic
1077285027 11:1761799-1761821 GCGCAGGTGCAGAGGGAGGACGG - Intronic
1077500803 11:2909098-2909120 GCGGGGCTGACCAGGGAGGCTGG - Intronic
1077525136 11:3059629-3059651 GGGAGGCTGAAGAGGGAGGATGG + Intergenic
1077782591 11:5347791-5347813 AGGGAGCAGAAGAGGGAGGGAGG + Intronic
1077884181 11:6373877-6373899 GGGAGGCTGAGGAGGGAGGATGG + Intergenic
1078478474 11:11655556-11655578 CAGTAGCTGAAGAGGGATGAAGG + Intergenic
1078594201 11:12673072-12673094 GGGAGGCTGAAAAGGGAGGATGG + Intergenic
1078659662 11:13277266-13277288 GGGGAGAAGAAGAAGGAGGAGGG + Intronic
1078858983 11:15230083-15230105 GGGAAGCTGAGGTGGGAGGATGG + Intronic
1078910281 11:15724623-15724645 GAGGAGCAGAAAAGGGAGAAGGG + Intergenic
1079569358 11:21923175-21923197 GAGGATCTAAAGAGGGAGAAAGG - Intergenic
1079802118 11:24882606-24882628 CCGAAGGTTAAGAGGGAGGAAGG - Intronic
1080309618 11:30874502-30874524 GCAGGGAGGAAGAGGGAGGAGGG + Intronic
1080352505 11:31401514-31401536 GCGGAGGGGAAGCAGGAGGATGG - Intronic
1080539062 11:33249499-33249521 GGGAGGCTGAAGAGGGAGGATGG - Intergenic
1080649990 11:34214642-34214664 GGGAGGCTGAAGTGGGAGGATGG - Intronic
1081501185 11:43668289-43668311 GCTGGTCTGAAGATGGAGGACGG - Intronic
1081716798 11:45256232-45256254 GTGGAGAAGAGGAGGGAGGAAGG - Intronic
1081998445 11:47378747-47378769 GCTAAGCTGGGGAGGGAGGATGG + Intergenic
1082791271 11:57348091-57348113 GGGGAAGGGAAGAGGGAGGAAGG + Intronic
1082800397 11:57410003-57410025 GAGGTACTGGAGAGGGAGGATGG + Exonic
1083309608 11:61777559-61777581 GCGGAGCTGCGGGGGAAGGAAGG + Intronic
1083489201 11:63002648-63002670 GTGGAGTAGGAGAGGGAGGAAGG - Intronic
1083696216 11:64444531-64444553 GCCCAGCTGAGGTGGGAGGATGG - Intergenic
1084322305 11:68380385-68380407 GCAGAGCTGAGGAGGCGGGAAGG + Intronic
1084640603 11:70423702-70423724 GCCTAGCTGCAGAGGGAGGGTGG + Intronic
1084835267 11:71797205-71797227 GGGAAGCTGAGGTGGGAGGATGG + Intronic
1085565889 11:77512987-77513009 GGGAAGCTGAGGTGGGAGGATGG + Intergenic
1085622555 11:78048413-78048435 AGGAAGCTGAAGTGGGAGGATGG + Intronic
1085684158 11:78606387-78606409 GGGGAGCTGAGGTGGGAGGAAGG - Intergenic
1086353005 11:85962198-85962220 GTTGCGCTGAAGAGGGAGGAGGG - Intronic
1086930863 11:92691498-92691520 GGGAGGCTGAAGTGGGAGGATGG - Intronic
1087076976 11:94134636-94134658 GGGGAGAGGAAGAGGGAGGGGGG - Intronic
1087653116 11:100891280-100891302 GAGCAACCGAAGAGGGAGGAGGG - Intronic
1088152875 11:106768225-106768247 GAGAAGCTGAGGAGGGAGGATGG - Intronic
1088668576 11:112119204-112119226 GGGAAGCTGAGGTGGGAGGATGG - Intronic
1088715333 11:112543949-112543971 GGGGAGCTGAAAAGGGAGTGGGG + Intergenic
1088896431 11:114082173-114082195 GGGTGGCTGAAGAGGGAGGATGG + Intronic
1089093618 11:115899398-115899420 GCAGAGCTGAGGAGGGAACATGG + Intergenic
1089129294 11:116199519-116199541 GCAGAGCTGGAGGGAGAGGAGGG + Intergenic
1089225590 11:116918296-116918318 GCGGAGTGTAAGAGGGTGGATGG - Intronic
1089961537 11:122621352-122621374 GGGGACCTTAAGGGGGAGGAAGG - Intergenic
1090130943 11:124141623-124141645 GCTGAGATGCAGAAGGAGGACGG - Exonic
1090172524 11:124617240-124617262 GAGCAGCTGAGGAGGGAGGCCGG - Intronic
1090246068 11:125216736-125216758 GTGGAGGGGAGGAGGGAGGAGGG - Intronic
1090287630 11:125513630-125513652 GGGAAGCTGAGGTGGGAGGATGG - Intergenic
1090330163 11:125925151-125925173 GCGGAGCTGAGCACGGTGGAAGG - Intergenic
1090412103 11:126516363-126516385 GGGGATCAGAAGTGGGAGGAGGG - Intronic
1090585336 11:128205996-128206018 GAGGAGCAAGAGAGGGAGGAGGG + Intergenic
1090744915 11:129697626-129697648 GGGGGGCTGGAGTGGGAGGACGG + Intergenic
1090863033 11:130671616-130671638 GCAGAGCTGTGGAGTGAGGAGGG + Intergenic
1090949868 11:131464096-131464118 GAGGGGCTGCTGAGGGAGGAGGG + Intronic
1091259840 11:134225195-134225217 GCCGAGCACAAGACGGAGGACGG + Exonic
1091274787 11:134342768-134342790 GCGGAGCCGCAGAGGGACCAGGG - Exonic
1091339403 11:134798641-134798663 GGGGAGCGAAGGAGGGAGGATGG + Intergenic
1091555351 12:1569341-1569363 GTGGGGTTGAAGAGGGAAGAAGG - Intronic
1091951229 12:4594582-4594604 GTGGAGCAGAGGAGGGAGCAGGG - Intronic
1092145880 12:6214449-6214471 GGGGGGCTGAGGAAGGAGGATGG - Intronic
1093170842 12:15858613-15858635 GCAAAGCTGGAGAGGAAGGAGGG + Intronic
1093174355 12:15895635-15895657 GGGAAGCTGAGGTGGGAGGATGG + Intronic
1093918732 12:24835690-24835712 GAGGGGCTGAGGTGGGAGGATGG - Intronic
1094436089 12:30422334-30422356 GGGAAGCTGAGGTGGGAGGATGG + Intergenic
1094474731 12:30832495-30832517 GCTGAGCTGAAGACGCAGAATGG + Intergenic
1095644444 12:44526738-44526760 GCGGAGCAGAAGAATGGGGAGGG + Intronic
1095729369 12:45489899-45489921 GAGAGGCTGAAGTGGGAGGATGG - Intergenic
1095743486 12:45632242-45632264 GGGGGGCTGAAGTGGGATGATGG + Intergenic
1095842533 12:46709874-46709896 TCCCAGCAGAAGAGGGAGGAGGG + Intergenic
1095879329 12:47115544-47115566 GGGAAGGAGAAGAGGGAGGAGGG - Intronic
1096256024 12:50062961-50062983 TCGGGACTGAAGAGGGAGAAGGG + Intronic
1096290361 12:50337397-50337419 GGGGGGCTGAGGTGGGAGGATGG - Intronic
1096316849 12:50575485-50575507 TGGGAGCTGAGGTGGGAGGATGG - Intronic
1096360358 12:50980119-50980141 GGGATGCTGAAGTGGGAGGATGG + Intronic
1096604939 12:52757933-52757955 GAGGGGCAGGAGAGGGAGGAGGG - Intergenic
1096613856 12:52820524-52820546 GTGGAGATGAAGAGGAAAGAAGG + Intergenic
1096743499 12:53711190-53711212 GGGGACCTGGAGAGGGAGGGGGG + Intronic
1096845858 12:54406045-54406067 GCAAAGCTGAAGAGGGAGCTAGG - Intronic
1097207572 12:57335826-57335848 GGGAAGCTGAAGCAGGAGGATGG + Intronic
1097263934 12:57735495-57735517 GGAAAGCTGCAGAGGGAGGAGGG - Intronic
1097806185 12:63967335-63967357 GGGAGGCTGAAGAGGGAGGATGG + Intronic
1098646057 12:72902545-72902567 GCAGAGTTAAAGAGGGAGGGAGG + Intergenic
1099009942 12:77279968-77279990 GGGAGGCTGAAGTGGGAGGATGG + Intergenic
1099304597 12:80937764-80937786 GCGGGGGTGGAGAGGGAAGACGG + Exonic
1099581691 12:84455863-84455885 GAGGAGCTGGAGATGGAAGAAGG - Intergenic
1099764275 12:86961677-86961699 GCACAGCTGAAGATGGAGGAGGG + Intergenic
1100184793 12:92127646-92127668 GGGGAGAAGAGGAGGGAGGATGG + Intronic
1100550779 12:95644572-95644594 GGGAGGCTGAAGTGGGAGGATGG - Intergenic
1100595478 12:96068237-96068259 GGGAGGCTGAGGAGGGAGGATGG - Intergenic
1100595579 12:96069019-96069041 GAGGGGCTGAAACGGGAGGATGG - Intergenic
1100975321 12:100116235-100116257 GGGAAGCTGACGTGGGAGGATGG + Intronic
1101323493 12:103694371-103694393 TTGGAGCTGAAGGGGGAGGAGGG - Intronic
1101408899 12:104453241-104453263 GACAAGATGAAGAGGGAGGAAGG - Intergenic
1101694925 12:107116150-107116172 GGGAAGCTGAGGTGGGAGGATGG - Intergenic
1101840970 12:108327373-108327395 GGGAGGCTGAAGCGGGAGGATGG + Intronic
1102191351 12:110991024-110991046 GCGGAGCAGGAGAGAGGGGATGG - Intergenic
1102348318 12:112173768-112173790 TGGGAGCTGAGGTGGGAGGATGG - Intronic
1102407571 12:112687008-112687030 GGGAGGCTGAAGTGGGAGGATGG + Intronic
1102494438 12:113309649-113309671 GGGGGGCTGAGGTGGGAGGATGG + Intronic
1102655804 12:114481333-114481355 CTGGCGCTGCAGAGGGAGGAAGG + Intergenic
1102765970 12:115433272-115433294 GGGGAGAAGAAGGGGGAGGAAGG + Intergenic
1102846781 12:116193204-116193226 GGGAGGCTGAAGTGGGAGGATGG + Intronic
1102883169 12:116501815-116501837 GGGAAGCTGAGGTGGGAGGATGG - Intergenic
1102963294 12:117107594-117107616 GCGGGGCTGAGGAGGGCAGATGG + Intergenic
1103005695 12:117418447-117418469 GGGGGGCTGAGGCGGGAGGATGG - Intronic
1103061992 12:117866139-117866161 GAGAAGCTGAGGTGGGAGGATGG - Intronic
1103072938 12:117959824-117959846 GGGAGGCTGAAGTGGGAGGAAGG + Intronic
1103097214 12:118141627-118141649 GTGGGGCTGAGGTGGGAGGATGG + Intronic
1103367038 12:120390876-120390898 GCCAGGCTGGAGAGGGAGGAAGG - Intergenic
1103633379 12:122281589-122281611 GGGAAGCTGAGGCGGGAGGATGG + Intronic
1103672429 12:122628849-122628871 GGGAGGCTGAAGTGGGAGGATGG + Intergenic
1103758012 12:123225337-123225359 GGGAAGCTGAGGTGGGAGGATGG + Intronic
1103942536 12:124508869-124508891 GGGGAGCTGAAGCGGGCTGATGG + Intronic
1103948174 12:124538468-124538490 GGGGAGAGGAAGAGAGAGGAGGG + Intronic
1104068992 12:125328526-125328548 CAGAAGCTGAAGAGGCAGGAAGG - Intronic
1104211856 12:126696603-126696625 GCTGAACTGCAGAGGCAGGAAGG + Intergenic
1104250784 12:127091507-127091529 GGGAGGCTGAAGTGGGAGGATGG - Intergenic
1104451178 12:128869269-128869291 GGGAAGCTGAGGTGGGAGGATGG - Intronic
1104567982 12:129902724-129902746 GCGGCTCTGAAGAAGGGGGATGG - Intronic
1105034169 12:132906649-132906671 GCGAGGCTGAGGCGGGAGGATGG + Intronic
1105385760 13:19928108-19928130 GAGAAGCTGAGGTGGGAGGATGG - Intergenic
1105408380 13:20150335-20150357 ACAGAGATGAAGAGGGAGGCAGG + Intronic
1106123977 13:26885126-26885148 GTGAGGCTGAAGAGGGAGAATGG - Intergenic
1106675883 13:31957633-31957655 GAGGAGGAGAAGAGGGGGGAAGG + Intergenic
1106679139 13:31992427-31992449 GGGAGGCTAAAGAGGGAGGATGG - Intergenic
1107237464 13:38189667-38189689 GGGAGGCTGAAGTGGGAGGATGG + Intergenic
1107463110 13:40623997-40624019 GGGAAGCTGAGGTGGGAGGATGG + Intronic
1107630352 13:42336347-42336369 CCGGCTTTGAAGAGGGAGGAAGG + Intergenic
1107874326 13:44776784-44776806 GGGAGGCTGAAGTGGGAGGATGG - Intergenic
1108311737 13:49199123-49199145 GGGGAGCTGAGGTGGGAGGATGG - Intronic
1108445985 13:50509486-50509508 GGGGGGCTGAAGAGGAAAGATGG - Intronic
1109398865 13:61798183-61798205 GGGAAGCAGACGAGGGAGGACGG + Intergenic
1110065698 13:71102835-71102857 GGGAGGCTGAAGTGGGAGGATGG - Intergenic
1110158894 13:72352140-72352162 GCAGAGATGATGAGGGTGGATGG + Intergenic
1110224805 13:73108924-73108946 GGGAGGCTGAAGTGGGAGGATGG - Intergenic
1110637552 13:77783395-77783417 GAGGAGAAGGAGAGGGAGGAGGG + Intergenic
1111247713 13:85562592-85562614 GGGAGGCTGAAGTGGGAGGAAGG + Intergenic
1111972784 13:94934307-94934329 GGGAAGCTGAGGTGGGAGGATGG + Intergenic
1112158342 13:96842119-96842141 GCTGAGCTCAAAAGAGAGGAGGG - Intergenic
1112203973 13:97305898-97305920 GAGGAGCGGAACAGGGAGGAAGG + Intronic
1112362598 13:98730833-98730855 TGGGAGCTGAAGAAGAAGGACGG - Intronic
1112497532 13:99916534-99916556 TGGGGGATGAAGAGGGAGGAAGG - Intergenic
1112716378 13:102190901-102190923 GTGGAGCTGAGAAGAGAGGATGG - Intronic
1112725376 13:102297789-102297811 GGGAAGCTGAGGTGGGAGGATGG + Intronic
1113631910 13:111893851-111893873 GCGGTGCTGTGGAGGGAGAAGGG + Intergenic
1113711602 13:112468926-112468948 GGGAGGCTGAAGTGGGAGGACGG - Intergenic
1114218983 14:20680520-20680542 GCGTATCTGGAGAGGGCGGAGGG - Intergenic
1114441002 14:22747528-22747550 GGGAGGCTGAGGAGGGAGGATGG + Intergenic
1114702401 14:24692342-24692364 GGGAGGCTGAAGTGGGAGGATGG + Intergenic
1115241477 14:31254559-31254581 GGGAGGCTGAGGAGGGAGGATGG - Intergenic
1115306959 14:31943622-31943644 GGGGAGCTGAGGAGTGAGGATGG + Intergenic
1115596250 14:34912291-34912313 GAGGGGCTGAGGTGGGAGGATGG + Intergenic
1116833239 14:49742965-49742987 GCGGGGCTGAGGTTGGAGGATGG + Intronic
1116833342 14:49744184-49744206 GGGAGGCTGAAGTGGGAGGATGG + Intronic
1117146585 14:52842080-52842102 GGGAGGCTGAAGAGGGAGAATGG - Intergenic
1117149312 14:52869122-52869144 GGGCAGCTGAAGAGGGAAGCAGG + Intronic
1117549906 14:56824595-56824617 GGGAAGCTGAGGTGGGAGGATGG - Intergenic
1118033384 14:61839921-61839943 GGGGAGCAGAAGAGGAAGAAGGG + Intergenic
1118277490 14:64398440-64398462 GGGAGGCTGAAGTGGGAGGATGG + Intronic
1118347108 14:64948400-64948422 GCAGAGCTGGAGGAGGAGGAGGG - Exonic
1118373796 14:65159480-65159502 GCGAAGCTGCAGTGGCAGGATGG - Intergenic
1118598851 14:67457352-67457374 GGGAGGCTGAAGTGGGAGGATGG + Intronic
1118667757 14:68088805-68088827 GCGTAACTGAAGAAGGAGGTTGG + Intronic
1118907723 14:70034617-70034639 GCAGAGCAGGAGAGGGAGCAGGG - Intergenic
1119420286 14:74504064-74504086 GCAGAGCTGAGGTGAGAGGAAGG + Intronic
1119500488 14:75122901-75122923 GGGAGGCTGAGGAGGGAGGATGG - Intronic
1119514806 14:75239750-75239772 GGGAAGCTAAAGTGGGAGGATGG - Intronic
1119532202 14:75370276-75370298 GAGGAGCTGAAGGAGGAGAATGG - Intergenic
1120184698 14:81382556-81382578 GGGGATGTGATGAGGGAGGAGGG + Intronic
1120198410 14:81512597-81512619 GAGGAGCTGAACAGGAAGAAAGG + Intronic
1120228606 14:81818538-81818560 GGGTAGGTGAAGAGGCAGGAGGG + Intergenic
1120840259 14:89079281-89079303 GGGAAGCTGAGGTGGGAGGATGG - Intergenic
1120880811 14:89413979-89414001 GAGGAGGAGAAGAAGGAGGAGGG + Intronic
1120963152 14:90143310-90143332 GGGAGGCTGAGGAGGGAGGATGG - Intronic
1121141578 14:91547100-91547122 GGGGGGCTGAGGTGGGAGGATGG + Intergenic
1121427029 14:93859726-93859748 ACTGACCTGAACAGGGAGGAAGG - Intergenic
1121553909 14:94822114-94822136 CCGAAGCTGTAGAGGGAAGATGG + Intergenic
1122517994 14:102321977-102321999 GGGGTGGGGAAGAGGGAGGATGG - Intronic
1122565823 14:102655048-102655070 GGGAGGCTGAGGAGGGAGGATGG - Intronic
1122856114 14:104561028-104561050 GGGAAGCTGATGATGGAGGAGGG - Intronic
1123430589 15:20212297-20212319 TTGGAGCTGAGGTGGGAGGATGG - Intergenic
1123753500 15:23377950-23377972 GGGAAGCTGAAGCAGGAGGATGG + Intergenic
1123791894 15:23729991-23730013 GGGAAGCTGAGGAGGGAGAATGG - Intergenic
1124109497 15:26773070-26773092 CCGGAGCGGAGGAGGGCGGAGGG + Exonic
1125181905 15:36887889-36887911 GAGGAGGTGAAGAGAAAGGACGG - Intergenic
1125624847 15:41099675-41099697 GGGAGGCTGAGGAGGGAGGATGG + Intronic
1125641465 15:41234052-41234074 GGGACGCTGAAGCGGGAGGATGG - Intronic
1125720269 15:41841991-41842013 GAGGAGGTGCAGAGGGAGGGAGG - Intronic
1126098618 15:45106495-45106517 GCTGGGCAGAGGAGGGAGGAGGG - Intronic
1126156249 15:45568151-45568173 GGGAGGCTGAAGTGGGAGGATGG + Intergenic
1126362800 15:47863577-47863599 GGGGAGGAAAAGAGGGAGGAAGG + Intergenic
1126664296 15:51062167-51062189 GAGAAGCTGAGGTGGGAGGATGG + Intronic
1126750615 15:51873136-51873158 GATGAGATGAAGAGAGAGGAAGG - Intronic
1126763567 15:51991765-51991787 GTGGAGATGCAGTGGGAGGATGG + Intronic
1127247426 15:57192491-57192513 GCGAGGCTGAGGTGGGAGGACGG - Intronic
1127443183 15:59032524-59032546 GAGGCGCTGACGTGGGAGGACGG - Intronic
1127903581 15:63359293-63359315 GGGGAGCTTTGGAGGGAGGAAGG - Intronic
1127906068 15:63377155-63377177 TCGGAGGTGAAGAGGAAGGCCGG - Intronic
1128056408 15:64702978-64703000 CTGGAGCAGATGAGGGAGGATGG + Intronic
1128194088 15:65734976-65734998 GAGGGGCTGAGGTGGGAGGATGG + Intronic
1128645179 15:69373061-69373083 GCTGATGTGAAGATGGAGGAAGG - Intronic
1128691569 15:69728065-69728087 AGGAAGCTGAAGTGGGAGGATGG - Intergenic
1128878769 15:71224113-71224135 GCAGAGCCCAAGAGTGAGGAGGG + Intronic
1128935930 15:71746632-71746654 GGGAAGCTGAGGTGGGAGGATGG - Intronic
1128966901 15:72068568-72068590 GGGGGGCTGAGGTGGGAGGATGG - Intronic
1129194203 15:73954530-73954552 GCTGAGCTGAGGAGGGCGGCTGG + Intergenic
1129283960 15:74508516-74508538 GGGAGGCTGAAGTGGGAGGATGG + Intergenic
1129342258 15:74893647-74893669 TCGGGGCTAAAGAGGCAGGAAGG + Intronic
1129393351 15:75231514-75231536 GGGAAGCTGAGGTGGGAGGATGG + Intergenic
1129530345 15:76260083-76260105 GCCCAGCTGAAGCAGGAGGATGG - Intronic
1129803767 15:78437635-78437657 GAGGAGCTGAGGCGGAAGGATGG + Intronic
1130225956 15:82058687-82058709 GAGGAGGAGAAGAGGGAGGATGG - Intergenic
1130312482 15:82767451-82767473 GAGGAGCTGGAGAGGCAGGAAGG + Intronic
1130347003 15:83056800-83056822 AGGGAGCTGAGGTGGGAGGATGG - Intronic
1130519428 15:84651008-84651030 GGGATGCTGAAGTGGGAGGATGG + Intronic
1130627749 15:85533443-85533465 TCAGAGCTCAAGAGGAAGGAGGG + Intronic
1130788161 15:87123252-87123274 GGGGAGGAGGAGAGGGAGGAAGG - Intergenic
1130959882 15:88652520-88652542 GGGGAGGGGAAGGGGGAGGAGGG - Intronic
1131268787 15:90934322-90934344 CCAGAGCTGAAGAGAGAGGTGGG - Intronic
1131792447 15:95979908-95979930 GCCGGGCTGAAGAGGTAGGCAGG + Intergenic
1132462149 16:60940-60962 GAGGAGCTGGAGATGGGGGAGGG + Intronic
1132717557 16:1299506-1299528 GCGGAGCTGGGGGAGGAGGAGGG - Intergenic
1133164555 16:3937372-3937394 GAGCGGCTGAAGCGGGAGGATGG + Intergenic
1133222232 16:4323694-4323716 GCAGAGCTGAAGCTGGAAGACGG - Intronic
1133232021 16:4371487-4371509 GCGGCCCTGGAGAGGCAGGATGG - Intronic
1133395294 16:5442304-5442326 GCGGAGCTGCAGAGGGAGCCAGG + Intergenic
1133602374 16:7351965-7351987 TTGGAGCTGAAAAGGAAGGAGGG + Intronic
1133765177 16:8832812-8832834 AAGACGCTGAAGAGGGAGGATGG - Intronic
1133792386 16:9019030-9019052 GGGAGGCTGAAGTGGGAGGATGG + Intergenic
1133840173 16:9400913-9400935 ACGGGGATGAAGAGGAAGGAAGG + Intergenic
1133989680 16:10694870-10694892 GTGGGGCTCATGAGGGAGGATGG - Exonic
1134273444 16:12754904-12754926 CAGGAGCTGAGGTGGGAGGATGG + Intronic
1134430827 16:14204213-14204235 GGGAGGCTGAAGAGGGAGGATGG - Intronic
1134449355 16:14354095-14354117 GGGGAGGGGCAGAGGGAGGAGGG + Intergenic
1134452862 16:14374057-14374079 GGGAAGCCGAGGAGGGAGGATGG - Intergenic
1134473064 16:14545081-14545103 AGGAAGCTGAAGTGGGAGGATGG + Intronic
1134556496 16:15170160-15170182 GGGAGGCTGAAGTGGGAGGATGG + Intergenic
1134562304 16:15221067-15221089 GTGGAATTGAAGAGGGCGGATGG - Intergenic
1134572553 16:15303822-15303844 GCGGAGGTAGAGAGGGAGGGAGG - Intergenic
1134917076 16:18081873-18081895 GGGAGGCTGAAGTGGGAGGATGG + Intergenic
1135112354 16:19699990-19700012 GGGAGGCTGAAGAGGGAGGATGG + Intronic
1135419387 16:22295119-22295141 GGGAAGCTGAGGTGGGAGGATGG + Intergenic
1135424440 16:22325349-22325371 CCGGACCTGGAGAGGGTGGAGGG + Intronic
1135548691 16:23382149-23382171 GGGAGGCTGAAGTGGGAGGATGG - Intergenic
1135668364 16:24354425-24354447 GCTGGGCTGAGGAGGGAGAATGG + Intronic
1135694706 16:24575793-24575815 GAGGAGAGGGAGAGGGAGGAGGG + Intergenic
1135694758 16:24575915-24575937 GAGGAGAGGGAGAGGGAGGAGGG + Intergenic
1135727907 16:24871373-24871395 GGGAGGCTGAAGTGGGAGGATGG - Intronic
1135937521 16:26793668-26793690 AAGGAGCAGAAGAGGGAGGGAGG - Intergenic
1136021288 16:27441904-27441926 GGGAGGCTGAAGTGGGAGGATGG + Intronic
1136021676 16:27444585-27444607 GCGGAACTCCAGGGGGAGGAGGG - Exonic
1136039015 16:27563350-27563372 ACGGAGCAGAAGAGGGATGTGGG + Intronic
1136040226 16:27572707-27572729 GGGGAGAGGAAGAGAGAGGAGGG + Intronic
1136081301 16:27854198-27854220 GGGGAGAGGAAGGGGGAGGATGG + Intronic
1136228799 16:28875418-28875440 GCGGAGCTGGACAGTGGGGAAGG - Intergenic
1136363503 16:29797171-29797193 GCGGTGCTAAGGAGGGAGCAAGG - Intronic
1136375592 16:29863314-29863336 GCAGAGGAGGAGAGGGAGGAAGG + Exonic
1136410810 16:30076038-30076060 GCGGAGTGAAAGAGGGAGGCAGG + Exonic
1136550416 16:30979756-30979778 GGGGAACTGAAGAGGGCGGCGGG - Exonic
1136565055 16:31064799-31064821 ACTGAGCTGAAGAAGGAAGATGG - Exonic
1136854048 16:33638920-33638942 TTGGAGCTGAGGTGGGAGGATGG + Intergenic
1136922799 16:34345888-34345910 CCAGAGCTGGGGAGGGAGGATGG - Intergenic
1136981774 16:35065918-35065940 CCAGAGCTGGGGAGGGAGGATGG + Intergenic
1137290792 16:47050620-47050642 GCGGGGCTGAAGATGTAGGATGG + Intergenic
1137592624 16:49703102-49703124 GCAGAGCCCAGGAGGGAGGAGGG - Intronic
1137617367 16:49855846-49855868 GCGGAGGAGAAGGGGGAGAAGGG - Intronic
1137826304 16:51498887-51498909 GGGAAGCTGAGGTGGGAGGATGG + Intergenic
1137977926 16:53046578-53046600 GGGAGGCTGAGGAGGGAGGATGG + Intergenic
1138594142 16:58020617-58020639 GAGGAGAGGAAGAGAGAGGAGGG - Exonic
1138803967 16:60071307-60071329 GCGAAACTAAAGAAGGAGGATGG + Intergenic
1139322155 16:66123608-66123630 GAGGAGGTTGAGAGGGAGGAAGG + Intergenic
1139328467 16:66169600-66169622 GAGGAGGAGGAGAGGGAGGAAGG + Intergenic
1139449028 16:67015661-67015683 GGGAAGCTGAGGTGGGAGGATGG + Intergenic
1139530669 16:67541168-67541190 GGGAGGCTGAAGTGGGAGGATGG - Intronic
1139538486 16:67595260-67595282 GAGAAGCTGAAGCAGGAGGATGG - Intronic
1139661068 16:68421231-68421253 GTGAAGCAGATGAGGGAGGATGG - Intronic
1139738216 16:69011695-69011717 GGGCAGCTGAGGTGGGAGGATGG - Intronic
1139770864 16:69275175-69275197 GAGAAGCTGAGGTGGGAGGATGG - Intronic
1140286742 16:73610049-73610071 GCTGAGATGAAGAGGAACGAGGG - Intergenic
1140316547 16:73903446-73903468 GGGAGGCTGAAGCGGGAGGATGG - Intergenic
1140442691 16:74999488-74999510 GCGGGGCGGAAGAGGCAGGCGGG - Exonic
1140526995 16:75631359-75631381 TCAGAGCTGAACAGGAAGGAGGG + Intronic
1140891952 16:79292401-79292423 GAGAGCCTGAAGAGGGAGGATGG + Intergenic
1140908488 16:79430109-79430131 GGAGAGCTGAAGCGGGAGGCTGG - Intergenic
1141124251 16:81388773-81388795 TCAGAGCTGAAGAGGAAAGAAGG - Exonic
1141149206 16:81552539-81552561 GTGGCTCTGAAGATGGAGGAAGG - Intronic
1141175119 16:81713640-81713662 GCGGGGCAGAGCAGGGAGGAAGG - Intergenic
1141213176 16:81999849-81999871 GTGGAGGTGAAGAGGCAGGTAGG + Exonic
1141475754 16:84272070-84272092 GAGGAGCTGGAGAGGGATGAAGG + Intergenic
1141540241 16:84714421-84714443 GGGAGGCTAAAGAGGGAGGATGG - Intronic
1141703011 16:85651048-85651070 GCGGAGGGGGAGGGGGAGGAGGG - Intronic
1141703024 16:85651071-85651093 GCGGAGGGGGAGGGGGAGGAGGG - Intronic
1141788199 16:86215771-86215793 TCGGCTCTGAAGATGGAGGAGGG - Intergenic
1141942043 16:87283541-87283563 GGGAAGCTGAGGTGGGAGGATGG + Intronic
1142160083 16:88552829-88552851 CAGGAGCTGGAGAGGCAGGAAGG + Intergenic
1142228126 16:88887345-88887367 GAGGGGCTGATGAGGGAGGGAGG - Intronic
1142369759 16:89672335-89672357 GAGGAGCTGGAGGGGAAGGAGGG - Intergenic
1142714781 17:1741535-1741557 GAGGAGCTGGACAGTGAGGATGG + Intergenic
1142746304 17:1960433-1960455 ACGGGGCTGGAGAGGGAGGTGGG - Intronic
1143032006 17:3973130-3973152 GCAGAGCTGATGAGGTGGGAGGG - Intergenic
1143212663 17:5200163-5200185 GGGAAGCTGAGGTGGGAGGATGG + Intergenic
1143516090 17:7419912-7419934 GGGGAAGTGACGAGGGAGGAGGG + Intergenic
1143576891 17:7798959-7798981 GGGGTGCTGAAGTGGGAGGATGG + Intronic
1143882941 17:10043673-10043695 GGGAGGCTGAAGTGGGAGGATGG + Intronic
1143894497 17:10125646-10125668 GGGGAGATGAGGAGGGAGGAGGG + Intronic
1144123371 17:12178462-12178484 GGGAGGCTGAAGTGGGAGGATGG - Intergenic
1144941210 17:18942520-18942542 GGGGTGCTGATGTGGGAGGATGG + Intergenic
1145398109 17:22511921-22511943 GTGGAGGTGAAGTGGGGGGAAGG - Intergenic
1145780716 17:27561039-27561061 GAGGAGCTGAAGTTGGAGCATGG + Intronic
1145951793 17:28824287-28824309 GAGGGGCTGAGGTGGGAGGATGG - Intronic
1146199417 17:30843245-30843267 GGGCAGCTGAGGTGGGAGGATGG + Intronic
1146534314 17:33637010-33637032 GGGGAGGAGAAGAAGGAGGAAGG - Intronic
1146655718 17:34633622-34633644 GCGGGGCTGGAGAGGGAAGCAGG + Intronic
1146725554 17:35152876-35152898 TCGGAGCTGAGGAGAGAGGAGGG - Exonic
1147672956 17:42187345-42187367 GGGAAGCTGAAGGGGGAGGATGG - Intergenic
1147909837 17:43848927-43848949 CAGGAGCTGCAGAGGGAAGAGGG + Intronic
1147970204 17:44215342-44215364 GCGGAGCCTAACAGTGAGGATGG + Intronic
1148167524 17:45493639-45493661 GGGGAGCTGAAGACTGAGCAAGG + Intergenic
1148347299 17:46912079-46912101 GGGAAGCTGCAGGGGGAGGATGG - Intergenic
1148382029 17:47206898-47206920 GTGGAGGTGGAGAAGGAGGAGGG + Intronic
1148461861 17:47843603-47843625 GAGGAGCTGCATGGGGAGGAGGG + Intergenic
1148467357 17:47872920-47872942 CCGGGGCTGGAGAGGGCGGAAGG + Intergenic
1149097145 17:52856641-52856663 GAAAAGCTGAAGTGGGAGGATGG - Intergenic
1149155200 17:53621073-53621095 GTGAGGCTGAAGTGGGAGGATGG + Intergenic
1149217399 17:54373608-54373630 ATGGGGCTGAGGAGGGAGGATGG + Intergenic
1149276924 17:55051651-55051673 GGGAGGCTGAAGTGGGAGGATGG + Intronic
1149619385 17:58031390-58031412 GGGGGGCTGAGGTGGGAGGATGG - Intergenic
1149738937 17:59024762-59024784 GGGATGCTGATGAGGGAGGATGG - Intronic
1149844947 17:60002957-60002979 GGGAAGCTGAAGTAGGAGGATGG + Intergenic
1149912304 17:60577760-60577782 ACTGAGCTGAGGAGGGAGGGTGG + Intronic
1149962547 17:61127799-61127821 GGGGAGTGGAATAGGGAGGAAGG + Intronic
1150233431 17:63572865-63572887 GGGAAGCTGAGGTGGGAGGATGG - Intronic
1150307167 17:64095573-64095595 GCAGACCTGGAAAGGGAGGAGGG - Intronic
1150311585 17:64133176-64133198 GGGAAGCTGAGGTGGGAGGATGG + Intergenic
1150370478 17:64633163-64633185 GGGAGGCTGAAGTGGGAGGATGG + Intronic
1150398705 17:64840052-64840074 GGGGAGCTGAAGACTGAGCAAGG + Intergenic
1150414824 17:64978319-64978341 GGGAGGCTGAAGTGGGAGGATGG + Intergenic
1150697100 17:67415117-67415139 GAGAAGCTGAGGAGGGTGGATGG - Intronic
1150743949 17:67801389-67801411 GGGAAGCTGAGGTGGGAGGATGG - Intergenic
1150808096 17:68335099-68335121 GGGGGGCTGAGGCGGGAGGATGG - Intronic
1151214603 17:72569106-72569128 TCAGAGCCGAGGAGGGAGGAAGG - Intergenic
1151436655 17:74101818-74101840 GGGGAGCTGCAGAGGAAGGGAGG - Intergenic
1151641702 17:75400100-75400122 GGGAAGCTGAGGCGGGAGGATGG - Intronic
1151917568 17:77129670-77129692 GCAGAGCTGAAGGTGGAGGAGGG + Intronic
1152030545 17:77839612-77839634 ACTGAGCTGAGGAGAGAGGAGGG - Intergenic
1152210786 17:79001958-79001980 GTGGGGCTGGGGAGGGAGGAGGG - Intronic
1152238767 17:79151415-79151437 GGGGACCTGCAGGGGGAGGAGGG + Intronic
1152238783 17:79151453-79151475 GGGGACCTGCAGGGGGAGGAGGG + Intronic
1152238799 17:79151491-79151513 GGGGACCTGCAGGGGGAGGAGGG + Intronic
1152238814 17:79151526-79151548 GGGGACCTGCAGGGGGAGGAGGG + Intronic
1152238829 17:79151561-79151583 GGGGACCTGCAGGGGGAGGAGGG + Intronic
1152238845 17:79151599-79151621 GGGGACCTGCAGGGGGAGGAGGG + Intronic
1152238860 17:79151634-79151656 GGGGACCTGCAGGGGGAGGAGGG + Intronic
1152238877 17:79151672-79151694 GGGGACCTGCAGGGGGAGGAGGG + Intronic
1152238892 17:79151707-79151729 GGGGACCTGCAGGGGGAGGAGGG + Intronic
1152238907 17:79151742-79151764 GGGGACCTGCAGGGGGAGGAGGG + Intronic
1152238937 17:79151815-79151837 GGGGACCTGCAGGGGGAGGAGGG + Intronic
1152238954 17:79151853-79151875 GGGGACCTGCAGGGGGAGGAGGG + Intronic
1152238969 17:79151888-79151910 GGGGACCTGCAGGGGGAGGAGGG + Intronic
1152400767 17:80065052-80065074 GAGGAGGGGGAGAGGGAGGAGGG - Intronic
1152730291 17:81966739-81966761 GCGCAGTCGGAGAGGGAGGAAGG + Intergenic
1152813013 17:82391096-82391118 GAGGAGGTGCTGAGGGAGGAGGG + Intronic
1152853523 17:82650529-82650551 GGGGGGCTGAGGAGGGAGGATGG + Intergenic
1152959347 18:69357-69379 GGGAGGCTGAAGCGGGAGGATGG + Intronic
1153699993 18:7683272-7683294 GAGAGGCTGAGGAGGGAGGATGG - Intronic
1153921051 18:9790473-9790495 GGGAAGCTGAAGCAGGAGGATGG - Intronic
1153987778 18:10368551-10368573 GAGGAGAGGGAGAGGGAGGAAGG + Intergenic
1154050734 18:10954595-10954617 GATGAGAAGAAGAGGGAGGAGGG + Intronic
1154145156 18:11861020-11861042 GAGGAGCTGGTGTGGGAGGATGG + Intronic
1154151163 18:11907750-11907772 GGGACGCTGAAGTGGGAGGATGG - Intronic
1154315012 18:13297553-13297575 GGGGGGCTGAGGTGGGAGGATGG + Intronic
1154336703 18:13471635-13471657 GTGGAGCTGGGGAGGGTGGAGGG + Intronic
1155030213 18:21977728-21977750 GGGAAGCTGAGGTGGGAGGATGG - Intergenic
1156862091 18:41849194-41849216 GGGAAGAAGAAGAGGGAGGAGGG + Intergenic
1157009361 18:43627978-43628000 ACGGAGCGGCAGTGGGAGGAAGG - Intergenic
1157470287 18:47983173-47983195 GGGGAGGAGAAGAAGGAGGAAGG - Intergenic
1157555515 18:48610591-48610613 GAGGCCCTGGAGAGGGAGGAAGG - Intronic
1157914815 18:51654686-51654708 GAGGAGGTGAAGGGGAAGGAGGG + Intergenic
1158296000 18:55997510-55997532 GTGAACTTGAAGAGGGAGGAGGG - Intergenic
1158477759 18:57795296-57795318 GGGAGGCTGAAGCGGGAGGATGG + Intronic
1158581609 18:58689045-58689067 GGGGTGCTGAGGTGGGAGGATGG + Intronic
1158593289 18:58795354-58795376 GGGAAGCTGCAGTGGGAGGATGG - Intergenic
1158619728 18:59022586-59022608 GCTGAGCTGACGTGGGTGGATGG + Intergenic
1158974080 18:62694762-62694784 GGGAAGCTGAGGTGGGAGGATGG - Intergenic
1159102619 18:63972167-63972189 GCGGATGTGATGAGGGAGGAGGG - Intronic
1160033162 18:75279558-75279580 GAGGAGCTGGAGCAGGAGGACGG + Intronic
1160255101 18:77241636-77241658 GGGAGGCTGAAGTGGGAGGATGG + Intergenic
1160266915 18:77346067-77346089 GGGAAGCTGAGGTGGGAGGATGG - Intergenic
1160438901 18:78873761-78873783 GTGGGGCTGAAGTGGGAGGATGG + Intergenic
1160486628 18:79299298-79299320 GAAGGGCTGGAGAGGGAGGAGGG - Intronic
1160671099 19:363939-363961 GCGAGGCTGAGGTGGGAGGATGG - Intronic
1160705187 19:526252-526274 TTGGAGGTGAAGGGGGAGGAAGG - Intergenic
1160726679 19:620709-620731 CCGGAGCTGCCGGGGGAGGAGGG + Intronic
1160803685 19:982013-982035 GGGAAGCTGAGGTGGGAGGATGG + Intergenic
1160860021 19:1233771-1233793 GAGGGGCAGAAGCGGGAGGAGGG + Intronic
1160916851 19:1500830-1500852 GAGGAGGGGAGGAGGGAGGAGGG + Intergenic
1161022819 19:2018841-2018863 GGGAGGCTGAAGTGGGAGGATGG + Intronic
1161207064 19:3046902-3046924 GGGGAGGAGGAGAGGGAGGAGGG - Intronic
1161214196 19:3085130-3085152 GGGGAGCTGAGGAGGGAGGGAGG + Intergenic
1161226660 19:3150114-3150136 GTGGTGCTGGGGAGGGAGGACGG - Exonic
1161243935 19:3238526-3238548 CAGAAGCTGAAGAGGCAGGAAGG - Intronic
1161244064 19:3239473-3239495 GGGAGGCTGAAGTGGGAGGATGG - Intronic
1161326908 19:3668437-3668459 GTGGCTGTGAAGAGGGAGGAAGG + Intronic
1161636216 19:5390892-5390914 GGGGAGATGGAGAGGGGGGAGGG - Intergenic
1161868079 19:6849243-6849265 GGGGAGCACTAGAGGGAGGAGGG - Intronic
1161895034 19:7073886-7073908 ACAGAGCTGTAGAGGGTGGACGG - Intronic
1162022282 19:7873391-7873413 GCGGAGCTGAGGAAGGAGGCTGG + Intronic
1162182018 19:8876431-8876453 ACTGAGCTGCAGAGGGAGAAGGG + Exonic
1162185255 19:8899974-8899996 GTGGGGCTGGGGAGGGAGGATGG + Exonic
1162186055 19:8905986-8906008 GTGGGGCTGGGGAGGGAGGATGG + Exonic
1162186976 19:8913460-8913482 GTGGGGCTGGAGAGGGAGGATGG + Exonic
1162376193 19:10306708-10306730 GGGAGGCTGAGGAGGGAGGATGG + Intronic
1162472647 19:10881663-10881685 GTGGAGCTGCAGAGAGAGCAGGG + Intronic
1162513307 19:11132789-11132811 GCGAGGCTGAGGTGGGAGGATGG + Intronic
1162648658 19:12068203-12068225 GGGAGGCTGAAGTGGGAGGATGG + Intronic
1162758103 19:12872482-12872504 CAGGACCTGAAGTGGGAGGAGGG + Intronic
1162825616 19:13249745-13249767 GCTGAGGTGGAGGGGGAGGATGG + Intronic
1163010209 19:14420494-14420516 GTGGAGGGAAAGAGGGAGGAAGG - Intergenic
1163280163 19:16311291-16311313 GGGAGGCTGAAGTGGGAGGATGG + Intergenic
1163303306 19:16461741-16461763 GCGGAGGTGAGGAGGTAGCAGGG + Intronic
1163577249 19:18118064-18118086 GCGGAGCCGGACAGGGAGGGGGG - Intronic
1163757492 19:19115062-19115084 GGGGGGCTGAGGTGGGAGGATGG - Intergenic
1163824947 19:19518035-19518057 GGGAGGCTGAAGCGGGAGGATGG + Intronic
1164292634 19:23881469-23881491 GGGGAGGAGAAGGGGGAGGAGGG + Intergenic
1164592647 19:29514639-29514661 GGGCAGATGAAGAGGAAGGAGGG + Intergenic
1164619182 19:29683732-29683754 GGGAAGCTGAGGTGGGAGGATGG - Intergenic
1164982498 19:32624827-32624849 GGGAAGCTGAGGTGGGAGGATGG + Intronic
1165300946 19:34968445-34968467 GGGAGGCTGAAGTGGGAGGATGG - Intergenic
1165374535 19:35432419-35432441 GTGGAGGTGGAGAGGGAGGGAGG + Intergenic
1165440938 19:35827078-35827100 GGGAGGCTGAAGTGGGAGGATGG - Intronic
1165465889 19:35974574-35974596 GGGAAGCTGAGGAGGGAGGATGG - Intergenic
1165543305 19:36510294-36510316 GGGAAGCTGAGGTGGGAGGATGG + Intergenic
1165721390 19:38082050-38082072 GCGGTGCCGAAGGGGGAGGAAGG - Exonic
1165816611 19:38646493-38646515 GGGAAGCTGAGGCGGGAGGATGG - Intergenic
1165842007 19:38793826-38793848 GGGGGGCTGAGGTGGGAGGATGG - Intergenic
1165920591 19:39295495-39295517 GCGAGGCTGAAGCAGGAGGATGG + Intergenic
1166015178 19:39974215-39974237 GTGGAGATTAGGAGGGAGGAAGG + Intronic
1166015726 19:39978062-39978084 GGGGAGCTGAGGCAGGAGGATGG - Intronic
1166079618 19:40435423-40435445 GGGGAGCAGAGGAGTGAGGAGGG - Intergenic
1166102516 19:40579215-40579237 GCAGAGCTGAGGTGGAAGGATGG - Intronic
1166298834 19:41903020-41903042 GGGGAGCTGAGGTGGGAGGATGG - Intronic
1166396591 19:42445680-42445702 GGGAAGCTGAGGTGGGAGGATGG + Intergenic
1166552657 19:43676714-43676736 GGGCAGCTGAGGTGGGAGGATGG - Intergenic
1166765649 19:45251266-45251288 GAGGGGCTGGGGAGGGAGGAAGG - Exonic
1166771613 19:45286606-45286628 GGGAGGCTGAAGTGGGAGGATGG + Intronic
1166789633 19:45391091-45391113 GGGAAGCTAAAGCGGGAGGATGG + Intronic
1166994985 19:46716032-46716054 GGTGTGCGGAAGAGGGAGGAAGG - Intronic
1167047161 19:47056658-47056680 GTGGGGCTGAGGTGGGAGGATGG + Intergenic
1167130927 19:47585237-47585259 ACTGAGCTGAAGATGGAAGACGG - Intergenic
1167148283 19:47695134-47695156 GCGGGGCTGAGCAGGGAGAATGG + Intronic
1167317592 19:48774406-48774428 GGGGGGCTGAAGTGGGAGGAAGG - Intergenic
1167380183 19:49133926-49133948 GCGGAGCTTAATAAGGAGGCTGG + Intronic
1167495870 19:49818503-49818525 GCGAAACTGAAGTGGGAGGGCGG - Intronic
1167540295 19:50082104-50082126 GGGAAGCTGAGGTGGGAGGATGG + Intergenic
1167560779 19:50225762-50225784 GTGGATCTGTTGAGGGAGGAGGG + Intronic
1167577771 19:50325944-50325966 GCGCAGCTGCAGAGGCTGGACGG + Intronic
1167602011 19:50459842-50459864 GAGGAGGTGAGGAGGGATGAGGG + Intronic
1167608575 19:50494906-50494928 GTGGAGGAGCAGAGGGAGGAGGG + Intergenic
1167609892 19:50501936-50501958 GAGGAGGTGATGAAGGAGGAGGG - Intergenic
1167622732 19:50568291-50568313 GCGGGCCCGAGGAGGGAGGAAGG - Intergenic
1167629409 19:50615694-50615716 GGGAAGCTGAGGTGGGAGGATGG - Intergenic
1167794273 19:51699112-51699134 AGGAAGCTGAAGTGGGAGGATGG - Intergenic
1167882184 19:52469263-52469285 GGGGAGCTGAGGCAGGAGGATGG - Intronic
1168529105 19:57113095-57113117 GGGAAGCTGAGGTGGGAGGATGG - Intergenic
1168726529 19:58585715-58585737 GAGGAGGGGAAGAGGGAGGGAGG - Intergenic
925404973 2:3600128-3600150 GCGAAGCTGAGGCGGGAGAATGG + Intronic
925421211 2:3713431-3713453 GTGGAGCAGCAGAGGGGGGAAGG - Intronic
925705932 2:6684772-6684794 GGGAAGCTGGAGAGGGAGGAGGG + Intergenic
925817359 2:7767056-7767078 GGGGACCTGGAGAGGGACGACGG - Intergenic
925981840 2:9183372-9183394 GGGGGGCTGAGGTGGGAGGATGG + Intergenic
926266787 2:11330727-11330749 GGGAAGATGAGGAGGGAGGAGGG + Intronic
926266852 2:11330921-11330943 GAGGAGAGGAGGAGGGAGGAAGG + Intronic
926624961 2:15083299-15083321 GTGGAGATGGAGAGGGAAGAAGG - Intergenic
927475600 2:23412135-23412157 GCGGTGCGGTAGAGGTAGGATGG + Intronic
927579069 2:24225272-24225294 GCGGTGCTGAGGAGGGGGCAGGG - Intronic
927947031 2:27141388-27141410 GTGGGGCTGAGGTGGGAGGACGG - Intergenic
928105834 2:28470076-28470098 GGGGAGGAGGAGAGGGAGGAGGG + Intronic
928264830 2:29802461-29802483 GGGGAGATGAAGGGAGAGGAGGG + Intronic
929290397 2:40184069-40184091 GCGAGGCTGAGGTGGGAGGATGG + Intronic
929621949 2:43364117-43364139 GGGAGGCTGAGGAGGGAGGATGG + Intronic
930123047 2:47775470-47775492 GGGGTGCCGAAGTGGGAGGATGG + Intronic
930675468 2:54196315-54196337 GGGAAGCTGAGGTGGGAGGATGG - Intronic
931241074 2:60453017-60453039 GGAGAGCGGGAGAGGGAGGAGGG + Intronic
932035756 2:68245255-68245277 GGGAGGCTGAGGAGGGAGGATGG + Intronic
932371070 2:71188393-71188415 GTGGAGCTGAAGAGGGGGATGGG - Exonic
932466796 2:71929245-71929267 GCGGAGATGAACACGAAGGAGGG - Intergenic
932478672 2:72024999-72025021 GCGTGGCTGGAGAGGCAGGAAGG - Intergenic
932726134 2:74181247-74181269 GGGAAGCTGAGGCGGGAGGATGG + Intergenic
933915802 2:86992146-86992168 GTGGGGCTGAGGTGGGAGGATGG + Intronic
934007191 2:87777756-87777778 GTGGGGCTGAGGTGGGAGGATGG - Intronic
934773155 2:96920874-96920896 GAGGAGCTGAAGACTGGGGAGGG + Intronic
934918004 2:98316540-98316562 GTGGGGCTGAAGTGGGAGAATGG + Intergenic
935180782 2:100689470-100689492 GAGGAGCTCAAGAGGGAACAAGG + Intergenic
935196595 2:100820059-100820081 GGGGAGGTGGAGAGGGAGGAGGG + Intergenic
935270872 2:101433114-101433136 GCAGAGCTGAACAAGGAGGCCGG - Intronic
935750382 2:106227573-106227595 GGGAAGCTGAAGTGGGAGGATGG - Intergenic
935770831 2:106418669-106418691 GTGGGGCTGAGGTGGGAGGATGG - Intronic
935807073 2:106759847-106759869 AGGGAGCTGAGGTGGGAGGATGG - Intergenic
935909250 2:107877268-107877290 GTGGGGCTGAGGTGGGAGGATGG + Intronic
935967386 2:108494267-108494289 GTGGGGCTGAGGTGGGAGGATGG + Intronic
936046741 2:109194409-109194431 GCGCAGCTGAAGACTGTGGATGG - Intronic
936120877 2:109743164-109743186 GGGAAGCTGAGGTGGGAGGATGG + Intergenic
936131028 2:109842408-109842430 GTGGGGCTGAGGTGGGAGGATGG + Intronic
936213669 2:110529077-110529099 GTGGGGCTGAGGTGGGAGGATGG - Intronic
936223818 2:110628308-110628330 GGGAAGCTGAGGTGGGAGGATGG - Intergenic
936422807 2:112383637-112383659 GTGGGGCTGAGGTGGGAGGATGG - Intronic
936503100 2:113082024-113082046 GTGGAGCTGGTGAGGGTGGATGG + Intergenic
937225912 2:120368567-120368589 GGTGAGGGGAAGAGGGAGGAGGG + Intergenic
937662864 2:124450924-124450946 GGGAGGCTGAGGAGGGAGGATGG + Intronic
937958889 2:127439491-127439513 GCGGGGCTGAGGTGGGAGGCAGG + Intronic
938054387 2:128203108-128203130 GTGGCACTGAGGAGGGAGGATGG - Intergenic
938817245 2:134917599-134917621 CCGAGGCTGAAGTGGGAGGATGG - Intergenic
939383428 2:141465652-141465674 GGGGGGCTGAGGTGGGAGGATGG - Intronic
940348294 2:152651190-152651212 GGGAGGCTGAAGTGGGAGGATGG - Intergenic
940648983 2:156421884-156421906 GGTAGGCTGAAGAGGGAGGAAGG + Intergenic
941074209 2:160989071-160989093 GCGGAGCAGAAAATGGATGAGGG - Intergenic
941295678 2:163736245-163736267 GCGGAGCTGGAGGGGGAGAAAGG + Intergenic
942067563 2:172285878-172285900 GCGGAGATCAAAAGGAAGGAAGG - Intergenic
943259451 2:185640248-185640270 AAGAAGCTGAAGTGGGAGGATGG + Intergenic
943305677 2:186258763-186258785 GGGAAGCTGAAGTGGGAGGATGG + Intergenic
944097324 2:195983463-195983485 GGGGAGCAGAAGAGAAAGGAGGG + Intronic
944818200 2:203401275-203401297 GAGGAGATGAAGGTGGAGGAGGG - Intronic
945155145 2:206830280-206830302 GGGAAGCTGAGGTGGGAGGATGG + Intergenic
945358856 2:208871133-208871155 GGGAGGCTGAAGTGGGAGGATGG + Intergenic
945547879 2:211180488-211180510 GTGGAGGTGAAGATGGATGAGGG + Intergenic
945777988 2:214131263-214131285 GGGAAGTTGAAGTGGGAGGATGG + Intronic
945848103 2:214972509-214972531 GTGGGGCTGAAGTGGGACGATGG - Intronic
945968975 2:216217874-216217896 GTGGAGCTGGAGCGGGAGGGAGG + Intergenic
946006237 2:216527317-216527339 GCCGGGCTGAGGTGGGAGGATGG - Intronic
946408120 2:219503071-219503093 GAGGGGCTGAAGTGGGAGGATGG - Intronic
946430900 2:219627123-219627145 GGGAAGCTGAGGCGGGAGGAGGG + Intergenic
946688258 2:222292665-222292687 GAGGTGCTGAGAAGGGAGGAAGG - Intronic
946692555 2:222320103-222320125 GCGGCGGTGCAGGGGGAGGAAGG - Intergenic
946731990 2:222718943-222718965 GGGAAGCTGAAGTGGGAAGATGG + Intergenic
947030044 2:225782988-225783010 AGGAAGGTGAAGAGGGAGGAGGG - Intergenic
948041151 2:234902593-234902615 TCTGACCTGGAGAGGGAGGAGGG + Intergenic
948053309 2:234994133-234994155 GTGGAGGGGAAGAGGGAGGGAGG - Intronic
948062796 2:235053886-235053908 GCGGAGCTGAAGAGGGAGGAAGG + Exonic
948196875 2:236103192-236103214 GCGGAGGTGAGGCCGGAGGATGG - Intronic
948227023 2:236319115-236319137 GCTGCGATGAAGAAGGAGGAGGG - Intergenic
948230997 2:236349220-236349242 ATGGAGCTGAAGAGTGAGGAGGG + Intronic
948448430 2:238052175-238052197 GGGAAGCTGAGGTGGGAGGATGG - Intronic
948575015 2:238944204-238944226 GCAGGGCTGCAGGGGGAGGAAGG + Intergenic
948770822 2:240250542-240250564 GGAGGGCTGAAGAGGGAGGAGGG + Intergenic
948856660 2:240733409-240733431 GCTGGGCTGAGGAGGGAGCACGG - Intronic
1168839713 20:901808-901830 GCGGGGCTGAGGCAGGAGGATGG + Intronic
1168853313 20:991178-991200 ACGGGGCTGAGGTGGGAGGATGG - Intronic
1168895798 20:1322674-1322696 GGGAAGCTGAGGTGGGAGGATGG - Intronic
1168910896 20:1445825-1445847 GCAGTGCTGAGGAGAGAGGATGG + Exonic
1169452329 20:5722565-5722587 GGGAGGCTGAAGTGGGAGGATGG + Intergenic
1169787390 20:9374526-9374548 GGTGAGGTGAAGAGGGAAGACGG + Intronic
1169872165 20:10259641-10259663 GGGGAGCTGAAGTGGGAGGATGG - Intronic
1170186877 20:13601171-13601193 GAGCGGCTGAAGTGGGAGGATGG + Intronic
1170273139 20:14550460-14550482 GCATGGCTGAAGAGGGAGGGAGG - Intronic
1170551664 20:17482093-17482115 GCGGAGCTGGGGAGGGAGGGCGG - Exonic
1171000414 20:21409380-21409402 GGGAAGCTGAGGTGGGAGGATGG - Intergenic
1171941186 20:31331312-31331334 GAGGAGCAGGAGAAGGAGGAGGG + Intergenic
1171960069 20:31486944-31486966 GGGGTGCTGAGGTGGGAGGATGG - Intergenic
1171986464 20:31664816-31664838 GTGGAGCAGAAGAGAGAGGGAGG + Exonic
1171991629 20:31700971-31700993 GCCCAGCTGATGAGGCAGGAAGG + Intronic
1172239241 20:33401319-33401341 ACGGTGTTCAAGAGGGAGGATGG - Intronic
1172302200 20:33858056-33858078 GTAGAACTGAAGAGGGAGGCTGG + Intergenic
1172427546 20:34865287-34865309 GCTGAGCTGAGGTGGGAGGATGG - Intronic
1172663087 20:36580703-36580725 GGGGGGCTGAAGTGGGAGGAAGG + Intronic
1172772156 20:37388160-37388182 GCAGAGCTGTGGAGGCAGGAAGG + Intronic
1173016126 20:39227442-39227464 GTGTATCTGAAGAGGGAGGCAGG - Intergenic
1173427386 20:42954924-42954946 GAGGAGAGGAAGAGGGAGAAGGG + Intronic
1173437624 20:43047076-43047098 TCTGAGGGGAAGAGGGAGGAGGG - Intronic
1173521138 20:43701232-43701254 ACGGAGCAGAGGAGGGAAGATGG - Intronic
1173531826 20:43775528-43775550 GGGAAGCTGAGGTGGGAGGATGG + Intergenic
1173845635 20:46186700-46186722 GATGAGCTGAAGGGTGAGGAGGG + Exonic
1174010697 20:47447281-47447303 GGGAGGCTGAGGAGGGAGGATGG + Intergenic
1174037268 20:47675970-47675992 CCAGAGCTGAGGCGGGAGGATGG - Intronic
1174153353 20:48501454-48501476 GAGGAGCTGGAGAGGCAGGGAGG - Intergenic
1174381316 20:50157094-50157116 GGGAAGCTGAGGTGGGAGGATGG - Intergenic
1175315114 20:58041695-58041717 GGGGAGCAGAAGAGGGAGTGTGG + Intergenic
1175354787 20:58355717-58355739 GGGAAGCTGAGGTGGGAGGATGG + Intronic
1175766172 20:61594278-61594300 GCTGAGCTGAGCAGGGAAGAAGG + Intronic
1175804215 20:61818433-61818455 TGGGAGCTGAAGTGGAAGGATGG + Intronic
1176182213 20:63755362-63755384 TAGGAGCTGAAGAGGCCGGAGGG - Intronic
1176378131 21:6096842-6096864 GGGGAGGAGAAGAGGAAGGAGGG + Intergenic
1177747016 21:25228654-25228676 GGGAAGCTGAGGTGGGAGGATGG + Intergenic
1177779449 21:25607291-25607313 GCGGGGCAGAGGAAGGAGGAGGG - Intronic
1178349905 21:31865322-31865344 GGGAGGCTGAGGAGGGAGGATGG + Intergenic
1178820427 21:35970236-35970258 GGGAGGCTGAAGTGGGAGGATGG + Intronic
1179497928 21:41786066-41786088 GGGAAGCTGAGGTGGGAGGATGG + Intergenic
1179548081 21:42125517-42125539 GAGGGGCTGAAGGGTGAGGAAGG - Intronic
1179745342 21:43441404-43441426 GGGGAGGAGAAGAGGAAGGAGGG - Intergenic
1179958691 21:44756047-44756069 ATGGAGAAGAAGAGGGAGGAGGG + Intergenic
1180244568 21:46538466-46538488 CCCGAGCTGCAGAGAGAGGATGG - Exonic
1180592651 22:16954313-16954335 ACGGGGCTGCAGTGGGAGGAGGG + Intergenic
1180613519 22:17112813-17112835 GACGAGCTGAAGAGGTGGGAGGG - Exonic
1180878135 22:19184843-19184865 GGGGAGGTGATGAGAGAGGAGGG - Intronic
1181133381 22:20747837-20747859 GGGAAGCTGAGGCGGGAGGATGG - Intronic
1181266351 22:21633128-21633150 GCGCAGCTGAAGAGAGAGGTGGG + Exonic
1181710141 22:24679451-24679473 GCGCAGCTGAAGTGGTAGGAGGG + Intergenic
1181738385 22:24900123-24900145 GTGGGGCTGAGGTGGGAGGAAGG - Intronic
1181760574 22:25055958-25055980 GGGAAGCTGAGGTGGGAGGATGG - Intronic
1181804321 22:25365943-25365965 GCAGAGCTGAAGAGATGGGAAGG - Intronic
1181830091 22:25553617-25553639 GGGAGGCTGAGGAGGGAGGATGG + Intergenic
1181950647 22:26551179-26551201 GGGAGGCTGAAGTGGGAGGATGG + Intronic
1182126069 22:27816756-27816778 AAGGATCAGAAGAGGGAGGAGGG - Intergenic
1182140622 22:27954425-27954447 GGGAGGCTGAAGTGGGAGGATGG - Intergenic
1182756899 22:32687653-32687675 GGTGAGCTCAAGAGGGAGGCGGG - Intronic
1182818961 22:33196776-33196798 GAGGAGGAAAAGAGGGAGGAGGG + Intronic
1183187278 22:36299436-36299458 GCGGGGCTGAAGAGGGGGAGGGG - Intronic
1183260129 22:36789432-36789454 GCAGAGGTGAAGACGGAGGCTGG - Intergenic
1183267361 22:36836928-36836950 GGGGAGATGAGGAGGGAGGCTGG + Intergenic
1183414640 22:37675387-37675409 GGGGAGGTGGAGAGGGATGAAGG + Intergenic
1183615707 22:38944075-38944097 GAGGAGAAGGAGAGGGAGGAAGG - Intergenic
1183657654 22:39198256-39198278 GAGAAGCTGAAGTGAGAGGATGG - Intergenic
1183673554 22:39287350-39287372 GAGGAGCTGCAGACGGAGCAGGG + Intergenic
1183689201 22:39378788-39378810 CCTGGGCTGCAGAGGGAGGATGG - Intronic
1183907802 22:41055496-41055518 GGGAGGCTGAAGTGGGAGGACGG - Intergenic
1184092491 22:42299844-42299866 GCGGAGGGGAGGAGGGAGGAGGG + Intronic
1184444872 22:44541187-44541209 GAGAAGCTGGGGAGGGAGGAAGG - Intergenic
1184558189 22:45244975-45244997 CTGGCACTGAAGAGGGAGGAAGG + Intergenic
1184723643 22:46330375-46330397 GGGAGGCTGAAGTGGGAGGATGG + Exonic
1184895031 22:47401711-47401733 GAGGGGCTGTAGAGGGAGCAGGG - Intergenic
1184932319 22:47690539-47690561 GTGGAGCTGGGGAGGGAGGGAGG - Intergenic
1184985546 22:48130868-48130890 ACGGGGCTGCAGAGGGAGGCGGG - Intergenic
1185039754 22:48497940-48497962 GCGGGGCTGAAGAGTGGGGTGGG + Intronic
1185039768 22:48497975-48497997 GCGGGGCTGAAGAGTGGGGTGGG + Intronic
1185039817 22:48498112-48498134 GCGGGGCTGAAGAGTGGGGTGGG + Intronic
1185039866 22:48498249-48498271 GCGGGGCTGAAGAGTGGGGTGGG + Intronic
1185206291 22:49541099-49541121 GCGCAGCTGAGGAGCGAGGCCGG - Intronic
949132396 3:519689-519711 GGGGGGCTGAGGTGGGAGGATGG - Intergenic
949159185 3:859854-859876 GTGCAGCTGAAGACGGGGGAGGG - Intergenic
949337009 3:2986017-2986039 GGGGGGCTGAGGTGGGAGGATGG - Intronic
949797832 3:7870199-7870221 GAGGTCCTGAAGATGGAGGAAGG + Intergenic
950007589 3:9701429-9701451 GAGGGGCTGAGGTGGGAGGATGG + Intronic
950418744 3:12884262-12884284 GCATGGCTGATGAGGGAGGAGGG - Intergenic
950493647 3:13320989-13321011 GCATCGCTGATGAGGGAGGAGGG - Intronic
950553451 3:13681441-13681463 GCTGAGCTCAGGAGGGAGGCTGG + Intergenic
950669813 3:14519324-14519346 GCAGAGCTGGAGGGTGAGGAAGG - Intronic
952332455 3:32376764-32376786 GCTGAGCTCCAGAGGGAAGACGG - Intergenic
952364443 3:32662564-32662586 GGGAAGCTGAAGTGGGAGGATGG + Intergenic
952732125 3:36649599-36649621 GAAGAGATGAAGAGGGAGGATGG - Intergenic
952997412 3:38898131-38898153 GGGAGGCTGACGAGGGAGGATGG + Intronic
953198679 3:40756968-40756990 GTGGAGCAGAGCAGGGAGGAGGG + Intergenic
953210152 3:40868471-40868493 GGGTAGCTGCAGAGGGAGAATGG - Intergenic
953340747 3:42132366-42132388 GGGGGGCTGAGGTGGGAGGATGG - Intronic
953365433 3:42340482-42340504 GAGGAGGGGAAGGGGGAGGAGGG + Intergenic
953369426 3:42374911-42374933 GGGGAGCTGAGGTGGGAGGATGG - Intergenic
953490930 3:43349916-43349938 TCGGGGCTGAAGAGTGGGGAAGG - Exonic
954163855 3:48740514-48740536 GCAGTTCTGCAGAGGGAGGAAGG + Intergenic
954271349 3:49512134-49512156 GGGAGGCTGAAGAGGGAAGAAGG - Intronic
954277210 3:49550344-49550366 ACAGAACTGAAGAGGAAGGAAGG - Intergenic
954313788 3:49789863-49789885 GGGAGGCTGAAGGGGGAGGATGG + Intergenic
954450939 3:50571353-50571375 GAGGACAGGAAGAGGGAGGAGGG + Intronic
954545576 3:51431864-51431886 GGGAGGCTGAAGTGGGAGGATGG + Intronic
955231406 3:57102163-57102185 AGGGGGCTGAAGTGGGAGGATGG + Intronic
955329076 3:58032031-58032053 GGGAGGCTGAAGTGGGAGGATGG - Intronic
955349297 3:58182181-58182203 GGGGAGGGGAGGAGGGAGGAGGG + Intergenic
955517429 3:59741316-59741338 GTGGGGCTGAAGCGGGAGGATGG - Intergenic
955704606 3:61715319-61715341 GGGAGGCTGAAGTGGGAGGATGG - Intronic
955790316 3:62582339-62582361 GGGAAGCTGAGGTGGGAGGATGG + Intronic
956212574 3:66816850-66816872 GGGAAGCTGAAGTGAGAGGATGG - Intergenic
956468672 3:69542720-69542742 GGGGAGGGGGAGAGGGAGGAAGG + Intergenic
956591614 3:70921370-70921392 GGGAGGCTGAAGTGGGAGGATGG - Intergenic
956706050 3:72000236-72000258 GAGAAGCTGAGGTGGGAGGATGG - Intergenic
958513869 3:95086881-95086903 ATGGAGGTGAAGTGGGAGGAAGG - Intergenic
958943110 3:100335905-100335927 GGGAAGCTGAGGAGGGAGAATGG + Intronic
959041014 3:101423708-101423730 GCTAGGCTGAAGAGGGAGGAAGG + Intronic
960446508 3:117756077-117756099 TTTGAGCTGAAGAGGAAGGATGG - Intergenic
960465845 3:117996495-117996517 GAGGAGGAGAAGAGGGAGGGAGG - Intergenic
960542671 3:118878881-118878903 GGGTGGCTGAAGTGGGAGGATGG - Intergenic
960639925 3:119814866-119814888 GGCGAGAGGAAGAGGGAGGATGG - Intronic
961229244 3:125287397-125287419 GGGAGGCTGAAGTGGGAGGACGG + Intronic
961345261 3:126260041-126260063 GAGGAGGGGAGGAGGGAGGAGGG - Intergenic
961424916 3:126837451-126837473 GGGAGGCTGAAGTGGGAGGATGG + Intronic
961443768 3:126968471-126968493 GAGGAGGAGAAGGGGGAGGAGGG + Intergenic
961444477 3:126972738-126972760 GTGGAGCTGGAAAGGGAGGGTGG - Intergenic
961612502 3:128152457-128152479 AAGGAGCAGGAGAGGGAGGATGG - Intronic
961621821 3:128230392-128230414 GGGAGGCTGAGGAGGGAGGATGG - Intronic
961886719 3:130101702-130101724 GGGAAGCTGAGGTGGGAGGATGG - Intronic
961987927 3:131157698-131157720 GCTGGGCTGAAGGGGGAGGAAGG + Intronic
962444571 3:135453115-135453137 GAGGAGGTGAAGAGGGCGGGAGG - Intergenic
962577377 3:136767352-136767374 GGGAGGCTGAAGTGGGAGGATGG + Intergenic
963200898 3:142584973-142584995 GAGAAGCTGAGGTGGGAGGATGG - Intergenic
963312259 3:143721753-143721775 GCAGTGGTGGAGAGGGAGGAAGG + Intronic
963505001 3:146173330-146173352 GTGGAACTGAAGAGGCAGGGTGG + Intergenic
965155007 3:165040183-165040205 GGGGAGTAGAAGAGGGAGAAAGG + Intronic
965376665 3:167932701-167932723 GTGGGGCTGAAGCAGGAGGATGG + Intergenic
965378878 3:167962719-167962741 GGGAGGCTGAGGAGGGAGGATGG + Intergenic
965575695 3:170216234-170216256 GGGAGGCTGAAGTGGGAGGATGG - Intergenic
965621344 3:170644950-170644972 GTGAAGCTGTAGAGGGAGGAGGG - Intronic
965723677 3:171689739-171689761 GGGAAGCTGAAGTGGGAGGGTGG - Intronic
965960421 3:174422723-174422745 TTGGGGCTGAGGAGGGAGGAAGG + Intergenic
966319463 3:178685023-178685045 GCAGAGTAGAAGAGGAAGGAGGG - Intronic
966395922 3:179502942-179502964 GGGAGGCTGAAGTGGGAGGACGG - Intergenic
966504049 3:180679340-180679362 GCTGAGCTGCACTGGGAGGATGG - Exonic
966537719 3:181052933-181052955 GTGGGGCTGAGGTGGGAGGATGG - Intergenic
966713119 3:182989540-182989562 TGGGAGCTGAGGAGAGAGGAAGG + Intergenic
966728150 3:183127236-183127258 GAGAAGCTGAGGTGGGAGGATGG - Intronic
966860697 3:184229802-184229824 GCAGAGCTGATGTGGGAGGAGGG - Intronic
966891889 3:184413250-184413272 GAGGGGTTGAAGAGGAAGGATGG - Intronic
966908573 3:184544755-184544777 GAGGAGGAGGAGAGGGAGGAGGG - Intronic
967106083 3:186256089-186256111 GCTGATCTGCAGAGGGTGGATGG - Intronic
967193824 3:187009525-187009547 GGGAGGCTGAGGAGGGAGGATGG + Intronic
967219885 3:187239631-187239653 GCGGAGCTGTAGAGGAATGGTGG - Intronic
967481446 3:189977847-189977869 GGGAGGCTGAGGAGGGAGGATGG - Intronic
967932805 3:194702682-194702704 GCGGAGGTGGAGAGGGAGGTTGG + Intergenic
967992628 3:195142777-195142799 GCAGCGCCGAACAGGGAGGATGG + Intronic
968115635 3:196087220-196087242 TGGGGGCTGAAGTGGGAGGATGG + Intergenic
968330818 3:197867917-197867939 GTGGGGCTGAGGCGGGAGGATGG + Intronic
968439221 4:613119-613141 GAGGAGGTGAAAAGCGAGGATGG + Intergenic
968459919 4:719668-719690 GTGGAGCTGGAGGGGCAGGACGG + Intronic
968505416 4:968967-968989 GCGCAGGTGAAGAGCGAGGAGGG - Intronic
968657881 4:1786468-1786490 GCTGAGCTGGAGTGGCAGGAGGG + Intergenic
968889162 4:3358881-3358903 GAGGAGGAGAAGGGGGAGGAAGG - Intronic
968889226 4:3359043-3359065 GGGGAGGGGAGGAGGGAGGAGGG - Intronic
968889383 4:3359398-3359420 GGGGAGGAGAAGGGGGAGGAGGG - Intronic
968944644 4:3657269-3657291 GGGGAGCGGGAGAGGGAAGAGGG - Intergenic
968974382 4:3813512-3813534 GCAGAGCTGAAGGTGGAGCAGGG - Intergenic
969049691 4:4363916-4363938 GGGGAGGTGACGAGGGAGGCAGG - Intronic
969055722 4:4401509-4401531 GAGGAGCTTACCAGGGAGGAGGG - Intronic
969417311 4:7069024-7069046 GCGGTGCTGAAGCGGGAGCCAGG - Intergenic
969507605 4:7597835-7597857 GTGGAACTGGTGAGGGAGGAGGG + Intronic
969659323 4:8517395-8517417 AGGGAGCAGAAGAGGGAGGGGGG + Intergenic
969721149 4:8893645-8893667 GCGGAACTGAGGAGGGAGCAGGG - Intergenic
969758097 4:9162992-9163014 GGGAAGCTGAGGTGGGAGGATGG + Intergenic
970191529 4:13523372-13523394 GTGAAGCTAAAGAGGGATGAGGG - Intergenic
970195578 4:13547600-13547622 GCGGAGGAGAAGCAGGAGGAGGG - Intergenic
970231621 4:13916733-13916755 GCGGAGGTGAGGAGGGAGGCTGG + Intergenic
970328635 4:14955690-14955712 CCAGAGCTGAAGATGGAGGCAGG + Intergenic
971181122 4:24329398-24329420 CCGGAGCTGGAGAGGCAGGTAGG - Intergenic
972348052 4:38210235-38210257 GGGAGGCTGAAGTGGGAGGACGG - Intergenic
972550548 4:40129151-40129173 GGGAGGCTGAAGTGGGAGGATGG - Intronic
973559020 4:52115709-52115731 GGGAGGCTGAAGTGGGAGGATGG - Intergenic
973620171 4:52718245-52718267 GGGAGGCTGAGGAGGGAGGATGG + Intergenic
973687708 4:53390041-53390063 GAGAAGGTGAAGTGGGAGGATGG - Intronic
974902768 4:68021684-68021706 GAGAGGCTGAAGTGGGAGGATGG - Intergenic
975028789 4:69586523-69586545 GGGAAGCTGAGGTGGGAGGATGG + Intergenic
975123015 4:70749752-70749774 GGGAAGCTGAGGTGGGAGGATGG - Intronic
975386246 4:73763582-73763604 GAGGAGCTGAAAAGGGAACAGGG - Intergenic
975816345 4:78221061-78221083 GGGAGGCTGAAGTGGGAGGATGG + Intronic
975884723 4:78951397-78951419 GAGGAGCTGAAAAAGGAGGTGGG + Intergenic
976339057 4:83924951-83924973 GGGGGGCTGAGGTGGGAGGATGG + Intergenic
976940664 4:90698863-90698885 GGGAGGCTGAAGTGGGAGGATGG + Intronic
977173374 4:93790068-93790090 GAGGAGGTGAAGTGGGGGGAGGG - Intergenic
977538551 4:98286025-98286047 GCGAAGCTGAGGCAGGAGGATGG + Intronic
978127774 4:105154918-105154940 GTGGGGCTGAGGCGGGAGGATGG + Intronic
978264837 4:106810974-106810996 GGGAAGCTGAAAGGGGAGGATGG - Intergenic
978508789 4:109492817-109492839 GGGAGGCTGAAAAGGGAGGATGG - Intronic
978558896 4:110010688-110010710 GAGAGGCTGAAGTGGGAGGATGG - Intronic
979244204 4:118480916-118480938 GGGGGGCTGAAGTGGGAAGATGG - Intergenic
979664526 4:123295805-123295827 GGGAGGCTGAAGTGGGAGGACGG + Intronic
979679523 4:123444431-123444453 GAGGAGCTGGGGAGGAAGGAGGG - Intergenic
979871243 4:125825113-125825135 GCCTAGGTGATGAGGGAGGATGG - Intergenic
979919710 4:126480851-126480873 GAGAAGCTGAACAGGGAGGACGG - Intergenic
980332894 4:131432214-131432236 GCGGAGCTGAAAGGAGAGGTTGG - Intergenic
980448460 4:132942225-132942247 GCAGAGCAGAAGAGAGAGAAAGG + Intergenic
980495822 4:133586841-133586863 GAGTAGCTGCATAGGGAGGATGG - Intergenic
980969788 4:139557174-139557196 GTGGAGCTAACGAGGAAGGAAGG + Intronic
981550436 4:145937147-145937169 GGGGAGCTGGAGAGGGAGTGGGG + Intronic
981800441 4:148649021-148649043 AAGGAGCTGAAGGGGGAGGGAGG + Intergenic
981911694 4:149988974-149988996 GGGAGGCTGAAGTGGGAGGATGG - Intergenic
982014160 4:151136250-151136272 GGGAGGCTGAAGTGGGAGGATGG - Intronic
983218790 4:165025195-165025217 GCTGAGCTGAAGAGGTAGTGGGG - Intergenic
983380291 4:166982445-166982467 GGGAGGCTGAAGAGGGAGAATGG + Intronic
983441775 4:167795524-167795546 GGGAAGCTGAGGTGGGAGGATGG - Intergenic
983775705 4:171604689-171604711 GGGGAGCGGAGGAGGGAGGAAGG - Intergenic
983856137 4:172647680-172647702 GCAGAGCTGTGGTGGGAGGAGGG - Intronic
984045537 4:174792942-174792964 ACGGAGCTGAAGAGAGGGGGTGG + Intronic
984118238 4:175709225-175709247 GAGGAGGAGAAGAGGGAGGAAGG - Intronic
984753111 4:183297758-183297780 GGGGAGCTGAAGAGAGACAAGGG + Intronic
984775754 4:183480466-183480488 GGGAAGCTGAAGAGGGAGGATGG + Intergenic
984911689 4:184679707-184679729 GCGGAGCTGAGGTGGGAAGGTGG - Intronic
984974828 4:185221135-185221157 GGGAGGCTGAAGTGGGAGGAAGG - Intronic
984983466 4:185304726-185304748 GCAGGGCTGAAGTGGGAGGATGG - Intronic
985131447 4:186742198-186742220 GGGATGCTGAAGTGGGAGGATGG - Intergenic
985491127 5:180323-180345 GGGGACCTGAAAAGGGAGCATGG - Intronic
985993812 5:3585064-3585086 GAGGAGGAAAAGAGGGAGGAGGG + Intergenic
986013860 5:3740677-3740699 GCGGCGCTGAAGATTGTGGAGGG - Intergenic
986192209 5:5508151-5508173 GGGGAACTGCAGAGGGAAGAGGG - Intergenic
986487630 5:8255102-8255124 GAGGGGGTGAAGAGGAAGGAAGG + Intergenic
986785734 5:11112360-11112382 CCGGATCTGAAGATGGTGGAAGG + Intronic
986892077 5:12320951-12320973 GCTGGGCTGAAGAGGGAGGAAGG - Intergenic
987157354 5:15103281-15103303 GACGAGCTGAGGAGGCAGGAAGG + Intergenic
987345352 5:16974029-16974051 CCGGGGCTGAGGTGGGAGGATGG - Intergenic
987396192 5:17426432-17426454 GTGGAGCTGGTGAGGGAGTAGGG - Intergenic
987808281 5:22799010-22799032 GGGAGGCTGAAGTGGGAGGATGG + Intronic
987933594 5:24434336-24434358 GCTCAGCTGAAGTGGGCGGATGG + Intergenic
988052157 5:26044274-26044296 GGGGGGCTGAGGAGGGAGGATGG + Intergenic
988973164 5:36489652-36489674 GGGAGGCTGAAGTGGGAGGATGG + Intergenic
989323539 5:40164860-40164882 CTGGGGTTGAAGAGGGAGGAAGG + Intergenic
989592147 5:43121590-43121612 GCGGGGGAGAAGAGGGAGGGCGG + Exonic
990134552 5:52630034-52630056 GGGAAGCTGAGGTGGGAGGATGG - Intergenic
990461825 5:56037786-56037808 GCAGAGCTGAGAAGGGAGGTTGG - Intergenic
990553084 5:56903810-56903832 GTGGAGATGGAGAGGGTGGATGG - Intergenic
990750207 5:59006475-59006497 GAGGTGCTGAGGTGGGAGGATGG + Intronic
990893808 5:60675707-60675729 GTGGGGCTGAAAAGGAAGGAAGG - Intronic
991013063 5:61903891-61903913 AGGAAGCTGAAGTGGGAGGATGG - Intergenic
991047828 5:62241262-62241284 TTGGAGCTGAGGTGGGAGGATGG - Intergenic
991258418 5:64640544-64640566 AGGAAGCTGAAGAGGGAGGATGG + Intergenic
991358547 5:65795281-65795303 GGGAGGCTGAAGGGGGAGGATGG + Intronic
991688475 5:69204393-69204415 TGGGAGCTGAGGTGGGAGGATGG - Intronic
992087143 5:73288034-73288056 GGGGAGCTAAGGTGGGAGGATGG + Intergenic
992465886 5:77003981-77004003 GGGAGGCTGAGGAGGGAGGATGG - Intergenic
992637936 5:78743319-78743341 GGGAAGCTGAGGTGGGAGGATGG - Intronic
993032091 5:82716252-82716274 GGGAAGCTGAAGCAGGAGGATGG - Intergenic
993168459 5:84385021-84385043 GAGGAGGGGAGGAGGGAGGAAGG - Intergenic
993472138 5:88319054-88319076 GGGAGGCTGAGGAGGGAGGATGG - Intergenic
993513670 5:88802549-88802571 GGGGGGCTGAAGGGGGAAGATGG - Intronic
994139429 5:96325582-96325604 GGGAGGCTGAAGTGGGAGGATGG - Intergenic
994377618 5:99032957-99032979 GTGGAGCTGAACAGGGAAAATGG - Intergenic
995499561 5:112789962-112789984 GGGAAGCTGAGGAGGGAGGATGG - Intronic
995747179 5:115416124-115416146 GGGGAGCTGTAGAGAGAGGTGGG + Intergenic
995886286 5:116898042-116898064 TCGGAGCTGAGCAGAGAGGAGGG + Intergenic
996410954 5:123158353-123158375 TTGGAGATGCAGAGGGAGGAAGG + Intronic
996595622 5:125199355-125199377 GGGGAGGAGAAGATGGAGGAGGG - Intergenic
996806106 5:127455842-127455864 GGGAGGCTGAAGTGGGAGGATGG - Intronic
996846844 5:127909108-127909130 GAGGAGCTGAAGAGAGAATAGGG + Intergenic
997034487 5:130172433-130172455 GGGAGGCTGAAGTGGGAGGATGG - Intronic
997117906 5:131145828-131145850 GGGGAGCTGAGGCCGGAGGATGG - Intergenic
997437449 5:133885502-133885524 GGGGAGCTGACGGGGGAGGAGGG + Intergenic
997744433 5:136286802-136286824 GAGGAGATGAAGACCGAGGAAGG - Intronic
997804598 5:136904851-136904873 GCTTAGCTGAAGCAGGAGGATGG - Intergenic
997910201 5:137864027-137864049 GGGATGCTGAAGTGGGAGGATGG + Intergenic
997967770 5:138373233-138373255 GTGGGGCTGAGGTGGGAGGATGG + Intronic
998316303 5:141185640-141185662 GGGAGGCTGAGGAGGGAGGATGG - Exonic
998404619 5:141867245-141867267 GCAGGGCTGAAAAGAGAGGATGG - Intronic
998656389 5:144185162-144185184 GCTGAGCAGTAGAGTGAGGATGG + Intronic
998729330 5:145056241-145056263 GCGAAGCAGAGGAGGGAGGGGGG - Intergenic
998957607 5:147453618-147453640 CCGGAGCAGAAGAAGGAGGGAGG - Intronic
999182671 5:149681109-149681131 GTGGAGCAGGGGAGGGAGGAGGG - Intergenic
999279437 5:150355413-150355435 GTGGAGTTGAAGAGAGTGGAAGG - Intergenic
999361892 5:150992540-150992562 CCGGAGCTGAAGGAGGAGGAGGG + Intergenic
999541701 5:152581792-152581814 GGGAGGCTGAAGTGGGAGGATGG - Intergenic
999656470 5:153815511-153815533 GGAGAGGGGAAGAGGGAGGAAGG + Intergenic
999757709 5:154677408-154677430 TGGGAGCTGAGGTGGGAGGATGG + Intergenic
999760225 5:154694359-154694381 GGGAGGCTGAAGAGGGAGGATGG - Intergenic
999968545 5:156835622-156835644 ATGGAGTTGAAGAGGGAGAATGG - Intergenic
1000983978 5:167847059-167847081 GGGAAGCTGAGGTGGGAGGATGG - Intronic
1001520843 5:172391565-172391587 GGGAGGCTGAAGTGGGAGGATGG - Intronic
1001651444 5:173318881-173318903 GAAGAGCTGAAGTGGGAGGGAGG + Intronic
1001972474 5:175967781-175967803 GTGGAGATGAGGAGGGAGTAGGG - Intronic
1002062111 5:176631268-176631290 GCGCAGCTGGAGAGCCAGGATGG + Intronic
1002091204 5:176807530-176807552 GCAGAGTTGAAGAGGAAGGCAGG + Intergenic
1002092699 5:176814290-176814312 GGGGCGATGACGAGGGAGGAAGG - Intronic
1002204475 5:177553634-177553656 GCGGAGCAGGGGAGGGAAGAAGG + Intronic
1002244965 5:177875999-177876021 GTGGAGATGAGGAGGGAGTAGGG + Intergenic
1002401691 5:178994751-178994773 GGGCAGCTGAAGAAGGAGCAGGG - Exonic
1003090268 6:3096074-3096096 GGGAAGCTGAAGAGGGCAGATGG - Intronic
1003160093 6:3627211-3627233 GGGAAGCTGAGGTGGGAGGATGG - Intergenic
1003460232 6:6321864-6321886 TTGGAGATGCAGAGGGAGGAGGG - Intergenic
1003550934 6:7101461-7101483 CTGGAGCAGCAGAGGGAGGAGGG - Intergenic
1003560500 6:7176020-7176042 CTGGAGCTGAGGTGGGAGGATGG - Intronic
1003778685 6:9398578-9398600 GAGGAGCCGAAGAGGGGCGAAGG - Intergenic
1003793082 6:9568386-9568408 GGGGCGCTGAACTGGGAGGATGG + Intergenic
1003908596 6:10723702-10723724 GGGAGGCTGAAGTGGGAGGATGG - Intronic
1004188643 6:13445149-13445171 CCGAGGCTGAACAGGGAGGAGGG + Intronic
1004262625 6:14121414-14121436 GGGAGGCTGAAGTGGGAGGATGG - Intronic
1004377643 6:15104544-15104566 GTGGTGGTGAAGAGGAAGGAGGG - Intergenic
1004650058 6:17600225-17600247 GCGGAGCTGGGAAGGGAGGGCGG - Intergenic
1004704955 6:18116209-18116231 GGGAGGCTGAGGAGGGAGGATGG + Intergenic
1004722023 6:18276030-18276052 GAAGAGGTGAAGAGGGAGGAGGG - Intergenic
1004918288 6:20352788-20352810 GCCAAGCTGAGGTGGGAGGATGG + Intergenic
1004973418 6:20937191-20937213 CAGGAGCTGAAGTAGGAGGATGG - Intronic
1005008572 6:21314095-21314117 GGGAAGCTGAGGCGGGAGGATGG - Intergenic
1005081924 6:21965306-21965328 GAGGAGGGGAAGAAGGAGGAGGG - Intergenic
1005081929 6:21965321-21965343 GAGGAGGGGAAGAAGGAGGAGGG - Intergenic
1005081934 6:21965336-21965358 GAGGAGGGGAAGAAGGAGGAGGG - Intergenic
1005081939 6:21965351-21965373 GAGGAGGGGAAGAAGGAGGAGGG - Intergenic
1005081944 6:21965366-21965388 GAGGAGGGGAAGAAGGAGGAGGG - Intergenic
1005081949 6:21965381-21965403 GAGGAGGGGAAGAAGGAGGAGGG - Intergenic
1005081954 6:21965396-21965418 GAGGAGGAGAAGAAGGAGGAGGG - Intergenic
1005280691 6:24270644-24270666 AGGGAGTTGAAGAGGGAGAAAGG + Intronic
1005887628 6:30108794-30108816 TCTGTGCTGAAGAAGGAGGAAGG + Intronic
1005953372 6:30647308-30647330 GCGGAGGAGAAGAGGGAGGGAGG + Exonic
1006718360 6:36134495-36134517 GGGGGGCTGAGGCGGGAGGATGG - Intronic
1006865553 6:37206637-37206659 GGGAAGCTGAGGCGGGAGGATGG - Intergenic
1007238049 6:40405243-40405265 GAGAAGCTGAAGAGGCAGCAGGG + Intronic
1007585926 6:42989460-42989482 GCGGAGCTGGGGTGGGTGGAGGG - Intronic
1007741022 6:44009574-44009596 GAGGAAGGGAAGAGGGAGGAAGG + Intergenic
1008036264 6:46748775-46748797 GGAGAGCTGAGGAGGGAGTAAGG - Intronic
1008111273 6:47497513-47497535 GGGAAGCTGAAGTGAGAGGATGG - Intronic
1008124009 6:47648644-47648666 GAGGAGGGGAAAAGGGAGGAAGG - Intergenic
1008558984 6:52704733-52704755 GGGAGGCTGAAGTGGGAGGATGG + Intergenic
1008756580 6:54802891-54802913 GCAGTGCTGAAGATTGAGGAAGG - Intergenic
1008800487 6:55362954-55362976 GAGGAGGAGAAGGGGGAGGAGGG + Intronic
1009059710 6:58384351-58384373 GCAGAGCTAAAGATGGAAGAGGG - Intergenic
1009231203 6:61063043-61063065 GCAGAGCTAAAGAGGGAAGAGGG + Intergenic
1009503374 6:64444895-64444917 GTGGAGGTGAAGTGGGAGGCAGG - Intronic
1010153332 6:72762298-72762320 AGGGAGGTGAAAAGGGAGGAGGG + Intronic
1011681910 6:89791730-89791752 GGGAGGCTGAGGAGGGAGGATGG + Intronic
1011721194 6:90158179-90158201 ACGGAGCTAAAGAGGTAGGCAGG + Intronic
1012321070 6:97846550-97846572 GGGAGGCTGAAGTGGGAGGATGG - Intergenic
1012795002 6:103748708-103748730 GGGGAGCTGGAGTGGGAAGATGG - Intergenic
1013192232 6:107813256-107813278 GGGAAGCTGAGGTGGGAGGATGG + Intronic
1013394638 6:109722929-109722951 TGGGAGCTGGAGAGAGAGGAAGG + Intronic
1013426839 6:110019653-110019675 GCTGAACTCAGGAGGGAGGATGG + Intergenic
1013525248 6:110968177-110968199 GGGCAGCTGACGTGGGAGGATGG + Intergenic
1013535886 6:111062552-111062574 GCGAGGCTGAGGTGGGAGGATGG + Intergenic
1013540302 6:111101723-111101745 GGGAGGCTGAAGTGGGAGGATGG - Intronic
1013797089 6:113900225-113900247 GGGAGGCTGAAGTGGGAGGATGG - Intergenic
1014314790 6:119850225-119850247 ACGGGGCTGAGGTGGGAGGATGG + Intergenic
1014684398 6:124477781-124477803 GGGAAGGGGAAGAGGGAGGAGGG - Intronic
1015932104 6:138371449-138371471 GGGACGCTGAAGTGGGAGGATGG + Intergenic
1018205771 6:161436068-161436090 GCAGAGATGAAGAGGCAGAATGG + Intronic
1018395470 6:163374977-163374999 GGGGTGATGAAGAGGAAGGATGG + Intergenic
1018449192 6:163890891-163890913 GAGGAGTTGAAGAAGGAGGAGGG - Intergenic
1018471362 6:164101175-164101197 GGGGGGCTGCAGATGGAGGAGGG - Intergenic
1018471369 6:164101195-164101217 GGGGGGCTGCAGATGGAGGAGGG - Intergenic
1018471391 6:164101257-164101279 GGGGGGCTGCAGATGGAGGAGGG - Intergenic
1018683249 6:166282143-166282165 ATGGAGCTGAAGAAAGAGGAGGG + Intergenic
1018844703 6:167547495-167547517 GATGGGGTGAAGAGGGAGGAGGG - Intergenic
1019004963 6:168789304-168789326 GCTGTGCTGAGGATGGAGGAAGG + Intergenic
1019042706 6:169119805-169119827 GAGAAGCTGGATAGGGAGGATGG - Intergenic
1019058792 6:169241338-169241360 GCATAGCTGAAGAGGCAGGACGG - Intronic
1019266745 7:121470-121492 GGGGAGCAGAGGAGGGAAGATGG + Intergenic
1019324606 7:432041-432063 GCGGAGTTGAAAAGGGATGCAGG + Intergenic
1019358436 7:592929-592951 GGGAGGCTGAGGAGGGAGGATGG + Intronic
1019494907 7:1333325-1333347 GAGGAGGTGAGGAGGGAAGAGGG - Intergenic
1019494948 7:1333420-1333442 GGGGAGGAGAAGGGGGAGGAGGG - Intergenic
1019632621 7:2057998-2058020 GCGGGGCTGGAGAGGGAGTGTGG + Intronic
1019632633 7:2058044-2058066 GCGGGGCTGGAGAGGGAGTGTGG + Intronic
1019632644 7:2058085-2058107 GCGGGGCTGGAGAGGGAGTGTGG + Intronic
1019632655 7:2058126-2058148 GCGGGGCTGGAGAGGGAGTGTGG + Intronic
1019632673 7:2058203-2058225 GCGGGGCTGGAGAGGGAGTGTGG + Intronic
1019632684 7:2058244-2058266 GCGGGGCTGGAGAGGGAGTGTGG + Intronic
1019632695 7:2058285-2058307 GCGGGGCTGGAGAGGGAGTGTGG + Intronic
1019632706 7:2058326-2058348 GCGGGGCTGGAGAGGGAGTGTGG + Intronic
1019632717 7:2058367-2058389 GCGGGGCTGGAGAGGGAGTGTGG + Intronic
1019632730 7:2058408-2058430 GCGGGGCTGGAGAGGGAGTGTGG + Intronic
1019632994 7:2059506-2059528 GCGGGGCTGGAAAGGGAGCATGG + Intronic
1019633038 7:2059634-2059656 GCGGGGCTGGAGAGGGAGCATGG + Intronic
1019664803 7:2246502-2246524 GCGGTGCTGAGGAGGCTGGATGG + Intronic
1019666097 7:2252938-2252960 GGGGAGCAGAAGAGGGATGAGGG - Exonic
1019985178 7:4650414-4650436 GCAGAGTTAAAGAGGGAGGAAGG - Intergenic
1020011341 7:4807506-4807528 GGGGAGACGGAGAGGGAGGAGGG - Intronic
1020011402 7:4807704-4807726 GGGGAGAAGGAGAGGGAGGAGGG - Intronic
1020137323 7:5594398-5594420 GCGGGGCAGACGCGGGAGGAGGG - Intronic
1020365783 7:7379143-7379165 GCGCAGCTGGAGAAGGACGAGGG + Intronic
1021117330 7:16759113-16759135 GTGGAGCGGATGTGGGAGGATGG + Intronic
1021171128 7:17399097-17399119 GAGGGGCTAAAGTGGGAGGATGG - Intergenic
1021697497 7:23288573-23288595 GGGAGGCTGAAGTGGGAGGATGG + Intergenic
1022218267 7:28286761-28286783 GGGAGGCTGAAGTGGGAGGAGGG + Intergenic
1022309838 7:29186465-29186487 GGGAGGCTGAGGAGGGAGGATGG + Exonic
1022486795 7:30785187-30785209 GCGGAGTGTAAGAGGGTGGATGG - Intronic
1022633216 7:32105640-32105662 GGGAGGATGAAGAGGGAGGATGG - Intronic
1023331284 7:39119628-39119650 GGGGAACTAAAGAGTGAGGAAGG + Intronic
1023430561 7:40086915-40086937 GGGAAGCTGAGGTGGGAGGATGG - Intronic
1023501324 7:40852760-40852782 GAGGGGCTGAAGTGGGAGAAAGG - Intronic
1023762833 7:43482798-43482820 GGGAGGCTGAAGTGGGAGGATGG + Intronic
1023828486 7:44025359-44025381 GGGAGGCTGAAGTGGGAGGATGG + Intergenic
1023876026 7:44286816-44286838 GCGCCGCTGAGGAAGGAGGAAGG + Intronic
1023960424 7:44921852-44921874 GCCGCCCTGAAAAGGGAGGAGGG + Intergenic
1023971725 7:44996558-44996580 GGGAGGCTGAAGTGGGAGGATGG + Intergenic
1024214149 7:47232345-47232367 GAGGAGCCAAAGGGGGAGGATGG + Intergenic
1024217026 7:47256416-47256438 GGGGAGCTGAAGAAAGGGGAGGG + Intergenic
1024274957 7:47669974-47669996 GGGAAGCTGAGGTGGGAGGACGG + Intergenic
1025056599 7:55770405-55770427 GGGAGGCTGAGGAGGGAGGATGG - Intergenic
1025083155 7:56001833-56001855 GGGAAGCTGAGGTGGGAGGATGG - Intergenic
1025212220 7:57026270-57026292 GGTGAGCTGCAGAGGGAGGATGG + Intergenic
1025249527 7:57342735-57342757 GTGGAGGTGAAGAGGCAGGGAGG - Intergenic
1025659734 7:63550558-63550580 GGTGAGCTGCAGAGGGAGGATGG - Intergenic
1025969746 7:66311241-66311263 AGGGAGCTGAGGTGGGAGGATGG - Intronic
1026181652 7:68046618-68046640 GGGAAGCTGAGGTGGGAGGATGG + Intergenic
1026222770 7:68415079-68415101 GAGGAGCTTAAGAGAGGGGAGGG - Intergenic
1026222778 7:68415115-68415137 GTGGGGCTTAAGAGAGAGGAGGG - Intergenic
1026222791 7:68415169-68415191 GGGGAGCTTAAGAGAGGGGAGGG - Intergenic
1026223125 7:68417766-68417788 GAGGAGCTTAAGAGAGGGGAGGG - Intergenic
1026223626 7:68421995-68422017 GGGAAGCTGAGGTGGGAGGATGG - Intergenic
1026683525 7:72488786-72488808 GGGAGGCTGAAGAGGGAGGATGG - Intergenic
1026842197 7:73676083-73676105 GGGAAGCTGAGGTGGGAGGATGG - Intergenic
1026975791 7:74497366-74497388 GGGAAGCTGAGGCGGGAGGATGG - Intronic
1027218673 7:76200765-76200787 GGGAGGCTGAAGTGGGAGGAAGG - Intergenic
1027520489 7:79200504-79200526 GGGGGGCTGAGGTGGGAGGATGG + Intronic
1027761462 7:82284625-82284647 GAGGAGCTGAAGAGCAAGGAAGG + Intronic
1028215932 7:88133256-88133278 GGGAGGCTGAAGTGGGAGGATGG + Intronic
1029082233 7:97983816-97983838 AGGAAGCTGAAGTGGGAGGATGG + Intergenic
1029350221 7:100008141-100008163 GCAGTGCTGAGGTGGGAGGAGGG - Intergenic
1029357503 7:100063132-100063154 TGGGAGCTGAGGCGGGAGGATGG - Intronic
1029374582 7:100170163-100170185 GCCCAGCTGAGGGGGGAGGAGGG + Exonic
1029421557 7:100474518-100474540 GGGGAGGTGGAGAGGGAGGAAGG - Intronic
1029675399 7:102065036-102065058 GGTGAGCTGCAGAGGGAGGATGG + Intronic
1029715246 7:102321992-102322014 GGGGTGCTGAAAAGAGAGGAGGG + Intergenic
1029756787 7:102578784-102578806 GGGAGGCTGAAGTGGGAGGATGG + Intronic
1029774726 7:102677853-102677875 GGGAGGCTGAAGTGGGAGGATGG + Intergenic
1030122627 7:106124920-106124942 GGGAGGCTGAAGTGGGAGGATGG + Intergenic
1030617869 7:111757115-111757137 GCGGAGGCTGAGAGGGAGGAGGG + Intronic
1031158527 7:118138868-118138890 GAGGACCTGAGGTGGGAGGATGG - Intergenic
1031453513 7:121951663-121951685 GAGGAGATGAAGAGGCAGGCTGG - Intronic
1031551639 7:123121253-123121275 CCAGAGCTGAATATGGAGGATGG - Intronic
1031630166 7:124034298-124034320 AAGGAGATAAAGAGGGAGGAAGG - Intergenic
1031859857 7:126966237-126966259 GTGGGGCTGAGGTGGGAGGATGG - Intronic
1031885591 7:127242990-127243012 GGGGAGCTGAAGAAGGAAAAGGG - Exonic
1031974551 7:128085493-128085515 TGGGAGCAGAAGAGGGAGAAAGG - Intronic
1031976313 7:128095694-128095716 GGGGAGTTTAGGAGGGAGGAAGG + Intergenic
1032063492 7:128745498-128745520 GGGAGGCTGAAGTGGGAGGATGG + Intronic
1032345175 7:131110069-131110091 CCGGAGCTGGAGGGGGAGGAGGG + Intergenic
1032917849 7:136511661-136511683 GAGGAGCTGGAGAGGGAGGCTGG + Intergenic
1033039859 7:137908271-137908293 GGGGAGCTGGAGAGGGCGGAGGG + Exonic
1033052657 7:138020590-138020612 ATGGAGCTGAAGTTGGAGGATGG - Intronic
1033087635 7:138357098-138357120 GTGAGGCTGAAGTGGGAGGATGG - Intergenic
1033272608 7:139946233-139946255 GAGGGGCTGAAATGGGAGGATGG + Intronic
1033345123 7:140520433-140520455 GTGGAGGTGTGGAGGGAGGATGG + Intronic
1033439655 7:141367147-141367169 GTGGACCAGCAGAGGGAGGAAGG + Intronic
1033712015 7:143957229-143957251 GCAGAGCAGGAGAAGGAGGAAGG + Intergenic
1034331760 7:150288911-150288933 GAGGTGCTGAGAAGGGAGGAAGG + Intronic
1034343551 7:150372352-150372374 TCGCAGCTGTAGAGGGAGGGGGG - Exonic
1034455028 7:151165382-151165404 GATGAGCTGAAGAGAGAGGATGG - Intronic
1034563712 7:151897222-151897244 GTGGGGCTGGAGAGGGAGCAAGG + Intergenic
1034608800 7:152345335-152345357 GCGAAGCTGAGGTGCGAGGATGG + Intronic
1034666278 7:152820959-152820981 GAGGTGCTGAGAAGGGAGGAAGG - Intronic
1034936289 7:155202922-155202944 GAGGAGCAGGAGAGAGAGGAGGG + Intergenic
1035695321 8:1591531-1591553 GTGGAGGTGGAGTGGGAGGAGGG - Intronic
1035782373 8:2238598-2238620 GGGGAGGTGAAGAGCGAAGAGGG + Intergenic
1035809746 8:2480990-2481012 GGGGAGGTGAAGAGCGAAGAGGG - Intergenic
1036158225 8:6362356-6362378 GGGCAGATGAAGAGGGAGGGTGG - Intergenic
1036473170 8:9069056-9069078 GCGAGGCTGAGGTGGGAGGACGG - Intronic
1036617982 8:10403551-10403573 GCGGCACTGAAGAGGAAGGCAGG + Intronic
1036719128 8:11156408-11156430 GCCCAGCTGAAGAGGCAGGCAGG - Intronic
1036932525 8:12969921-12969943 GGGAAGCTGAGGTGGGAGGATGG - Intronic
1037172849 8:15914124-15914146 CTGGAAGTGAAGAGGGAGGAGGG + Intergenic
1037818779 8:22125611-22125633 AGGCAGCTGGAGAGGGAGGAGGG - Exonic
1037837964 8:22225378-22225400 AGGAAGCTGAGGAGGGAGGATGG + Intronic
1038378911 8:27073819-27073841 GAGAAGCTGAAGAGGAAGGATGG + Intergenic
1038401469 8:27287722-27287744 GTGGAGCTGGAGTGTGAGGAGGG - Exonic
1038814091 8:30883213-30883235 GGGAAGCTGAAGCAGGAGGATGG - Intronic
1039088356 8:33802286-33802308 GGGAGGCTGAAGTGGGAGGATGG - Intergenic
1039131347 8:34267819-34267841 TCGGAGCTTAAGAAGAAGGAAGG - Intergenic
1040046797 8:42972637-42972659 GGGAAGCTGAGGTGGGAGGATGG - Intronic
1040972766 8:53155055-53155077 GGGGAGATGAAGGGAGAGGACGG + Intergenic
1041056788 8:53994238-53994260 GGGAGGCTGAAGTGGGAGGATGG + Intronic
1041066894 8:54091107-54091129 GGGAAGCTGAGGTGGGAGGATGG - Intronic
1041125663 8:54635967-54635989 GAGGAGAGGAAGAGGGAGAAAGG - Intergenic
1041126884 8:54650676-54650698 GGGGAGGGGAGGAGGGAGGAGGG - Intergenic
1041167190 8:55102054-55102076 GAGGAGAGGAAGCGGGAGGAGGG + Intergenic
1041330543 8:56719397-56719419 GCAGAGGAGAAGCGGGAGGAGGG - Intergenic
1041602146 8:59731749-59731771 GGGGAGAAGAAGAGGGAGGGTGG + Intergenic
1041674131 8:60521053-60521075 GGGAGGCTGAAGTGGGAGGATGG - Intronic
1041980397 8:63851478-63851500 GGGAGGCTGAAGTGGGAGGATGG + Intergenic
1043125120 8:76383775-76383797 GGGAGGCTGAAGTGGGAGGATGG - Intergenic
1044240979 8:89888514-89888536 GGGAGGCTGACGAGGGAGGATGG + Intergenic
1044266575 8:90188888-90188910 GGGGGGCTGAAGCGGGAGGATGG + Intergenic
1044667711 8:94647900-94647922 GGGAGGCTGAGGAGGGAGGATGG + Intronic
1044735694 8:95275813-95275835 GGGAGGCTGAAGTGGGAGGATGG - Intergenic
1045022764 8:98058789-98058811 GGGAGGCTGAAGTGGGAGGATGG + Intergenic
1045028591 8:98114087-98114109 GGGAAGCTGAGGTGGGAGGATGG + Intronic
1045081825 8:98634141-98634163 GTGGAGCTGGACAGGAAGGAGGG + Intronic
1045252483 8:100493459-100493481 GTGGGTGTGAAGAGGGAGGAGGG + Intergenic
1045453213 8:102349408-102349430 GGGAGGCTGAAGTGGGAGGATGG + Intronic
1046157217 8:110308419-110308441 GGGGAGGCAAAGAGGGAGGATGG + Intergenic
1046527903 8:115404861-115404883 TTGGAGCTGAAGAGGGAGTTGGG - Intergenic
1047481645 8:125288897-125288919 GGGCAGCTGAGGTGGGAGGATGG - Intronic
1048001419 8:130382468-130382490 GAGAAGCAGAACAGGGAGGAAGG + Intronic
1048838960 8:138547841-138547863 GCTTGGCTGGAGAGGGAGGAAGG + Intergenic
1049060202 8:140270695-140270717 CCGGAGCTGAGGAGGCAGGAGGG + Intronic
1049277170 8:141725710-141725732 GAGCAGCTGCAGAGGGAGGGAGG - Intergenic
1049351653 8:142167847-142167869 GGGCAGGTGCAGAGGGAGGAAGG - Intergenic
1049454853 8:142681637-142681659 GAGGAGTGGAAGATGGAGGATGG - Intronic
1049789423 8:144466041-144466063 GCGGGGCTGTAGGGAGAGGAAGG + Exonic
1049873502 8:145000154-145000176 GCAGAGCTGTAGGGAGAGGAGGG + Intergenic
1049958778 9:718415-718437 GGGAAGCTGAAGAGGGAGGATGG - Intronic
1050204017 9:3178607-3178629 GGGAAGCTGAGGAGGGAGGATGG + Intergenic
1050372219 9:4933618-4933640 GGGAAGCTGAGGTGGGAGGATGG - Intergenic
1050465524 9:5918718-5918740 GGGGGGCTGAGGTGGGAGGATGG + Intronic
1050515632 9:6441267-6441289 GGGAGGCTGAAGTGGGAGGATGG + Intronic
1051116367 9:13698388-13698410 GCTGAGCTGAAGGGGGAAGAAGG - Intergenic
1051738153 9:20224683-20224705 GCAGAGAAGAAGAGGGAGGGAGG + Intergenic
1052407012 9:28073786-28073808 GGGGAGCTGAAGTAGGAGGATGG + Intronic
1052917887 9:33938099-33938121 GGGAAGCTGAGGTGGGAGGATGG - Intronic
1052986532 9:34491961-34491983 GAGGACTTGAAGGGGGAGGAGGG - Intronic
1053124442 9:35568395-35568417 GGGAAGCTGAGGCGGGAGGATGG + Intergenic
1053153563 9:35757554-35757576 AGGGACCTGAGGAGGGAGGAGGG + Exonic
1053287540 9:36859581-36859603 GAGGAGCCGGGGAGGGAGGAGGG - Intronic
1053318663 9:37075765-37075787 GCGCAGCTGAATTGGGATGAGGG - Intergenic
1053328606 9:37181922-37181944 GGGAAGCTGAAGTGGGAGGATGG - Intronic
1053394117 9:37756927-37756949 GGGAAGCTGAGGTGGGAGGATGG + Intronic
1053397087 9:37785075-37785097 GCGGAGCGGAAGCGGAAGGCGGG - Intronic
1053452773 9:38207106-38207128 GGGAGGCTGAAGTGGGAGGATGG - Intergenic
1053543071 9:38994334-38994356 GTTGGGCTGAAGGGGGAGGAAGG - Intergenic
1054915544 9:70492302-70492324 GGGGGGCTGAGGTGGGAGGATGG + Intergenic
1055564989 9:77559392-77559414 GGGGAGCTGAAGACAAAGGACGG + Intronic
1055621615 9:78131495-78131517 GGGAGGCTGAAGTGGGAGGATGG + Intergenic
1055931716 9:81566040-81566062 GCAGAGCTGGTGATGGAGGACGG - Intergenic
1056123305 9:83510853-83510875 GGGGAAATGAAGAGGGTGGAGGG + Intronic
1056717957 9:89048800-89048822 GCGGAGCTGAAACGGAAGGCAGG + Intronic
1056776568 9:89517184-89517206 GGGAAGCTGCAGTGGGAGGATGG - Intergenic
1056791012 9:89625378-89625400 GGGAGGCTGAAGTGGGAGGATGG - Intergenic
1056868751 9:90256474-90256496 GAGGAGGTGAAGGAGGAGGAGGG + Intergenic
1056965179 9:91159418-91159440 GAGGAGCGAAGGAGGGAGGAAGG + Intergenic
1057028416 9:91755048-91755070 GGGAGGCTGAAGGGGGAGGATGG + Intronic
1057418467 9:94887241-94887263 GGGGAGCTGAGGTGGGAGGATGG + Intronic
1057497418 9:95571969-95571991 GAGGAGGAGGAGAGGGAGGAGGG + Intergenic
1057995284 9:99817333-99817355 GTGGAGAAGAAGAGGAAGGAGGG + Intergenic
1058489030 9:105475341-105475363 TCACAGCTGAAGAGGGAGAATGG + Intronic
1058550215 9:106106715-106106737 GGGAGGCTGAAGTGGGAGGATGG + Intergenic
1058989892 9:110245512-110245534 GGGAGGCTGAGGAGGGAGGATGG - Intronic
1059314220 9:113410445-113410467 GCGGGGCTGTGGGGGGAGGAGGG - Intronic
1059770549 9:117419844-117419866 GGGAAGCTGAGAAGGGAGGATGG - Intergenic
1059822944 9:117994229-117994251 GGAGAGCTGGAGAGGAAGGAGGG - Intergenic
1060185277 9:121560356-121560378 GGGGAGAGGAAGAGGGAGAAAGG + Intergenic
1060935938 9:127516031-127516053 GGGGGGTTGAAGTGGGAGGATGG + Intronic
1060936732 9:127520341-127520363 TGGGAGCTGAAGCGGGAGAATGG - Intronic
1060940456 9:127540348-127540370 GCTGAGCTGAGAATGGAGGAAGG + Intronic
1061156744 9:128867282-128867304 GGGAAGCTGAGGTGGGAGGATGG - Intronic
1061345862 9:130024343-130024365 GGGAGGCTGAAGTGGGAGGATGG + Intronic
1061375999 9:130225085-130225107 GGGAGGCTGAAGTGGGAGGATGG + Intronic
1061449939 9:130662478-130662500 GCGCTGCTGAGGAGGGAGGTGGG - Intergenic
1061673308 9:132201460-132201482 GCGGAACTGAAGAGGGAAAAGGG - Intronic
1061865664 9:133490768-133490790 GAGGAGGAGGAGAGGGAGGAGGG + Intergenic
1062075168 9:134584426-134584448 GAGAAGCTGAGGTGGGAGGATGG - Intergenic
1062107234 9:134762384-134762406 GAGGAGCAGAAGAGGGTGGGGGG + Intronic
1062514954 9:136928414-136928436 GCTGAGCAGAAGAGGGCTGAGGG + Intronic
1062738774 9:138154523-138154545 GGGAGGCTGAAGCGGGAGGATGG - Intergenic
1185888210 X:3801843-3801865 CAGGAGCTGGAGAGGCAGGAAGG + Intergenic
1186415914 X:9382800-9382822 GGAGGGCTGAAGAGGGAGGCAGG - Intergenic
1186781685 X:12918636-12918658 GGGAGGCTGAAGTGGGAGGATGG - Intronic
1186896525 X:14009451-14009473 GCGAGGCTGAGGTGGGAGGATGG + Intronic
1186977142 X:14919655-14919677 ACTGAGCTGAAGAGGGAAGAGGG - Exonic
1186979641 X:14945299-14945321 GGGAGGCTGAAGTGGGAGGATGG - Intergenic
1187031311 X:15491287-15491309 GCTGAGCTGTAGAGGATGGAGGG + Exonic
1187138182 X:16568653-16568675 GAGAGGCTGAAGTGGGAGGATGG - Intergenic
1188384160 X:29535027-29535049 GGGAAGCTGAAGTGGGAGGATGG + Intronic
1188820764 X:34771893-34771915 GGAGAGCTGAGAAGGGAGGAGGG + Intergenic
1188835091 X:34945261-34945283 GGGGGGCTGAGGTGGGAGGATGG + Intergenic
1189007739 X:37012013-37012035 GGGGGGCTGAGGTGGGAGGATGG + Intergenic
1189247117 X:39571810-39571832 GGGAGGCTGAGGAGGGAGGATGG + Intergenic
1189307493 X:39997785-39997807 GGGAGGCTGAAGTGGGAGGATGG + Intergenic
1189436643 X:40998866-40998888 GGGAGGCTGAAGTGGGAGGATGG - Intergenic
1189761814 X:44329705-44329727 GGGAGGCTGAAGTGGGAGGATGG - Intronic
1189763263 X:44343792-44343814 GCGGGGATGAAGCGGGTGGAGGG - Intergenic
1190213959 X:48467985-48468007 GGGGAGCTGAAGAAGGGGGGAGG + Intronic
1190220743 X:48511048-48511070 GGGGAGCTGGAGAGGGTGGCAGG - Intronic
1190308229 X:49098700-49098722 GGGGGGCTGAGGTGGGAGGATGG + Intronic
1190732932 X:53236474-53236496 GCGGAGCTGGAGAAGCAGAAAGG - Exonic
1190753573 X:53382031-53382053 GCTGAGCAGATGAGGGTGGATGG + Intronic
1190850350 X:54234265-54234287 GGGAAGCTGAGGTGGGAGGATGG + Intronic
1192130658 X:68546650-68546672 GGGAAGCTGAGGTGGGAGGATGG - Intergenic
1192163462 X:68807145-68807167 GAGGAGCTGAAGAGGAAAGCAGG + Intergenic
1192166598 X:68830676-68830698 GCCGAGCTGTTGAGGGAGGTGGG + Intronic
1192182391 X:68924353-68924375 GTGGAGCTGGAGAGAGAAGAGGG - Intergenic
1192318785 X:70072215-70072237 AAGAAGCTGAAGAGGGAGGCAGG + Intergenic
1192639091 X:72846163-72846185 GAGGAGGAGAAGAAGGAGGAGGG + Intronic
1192642620 X:72874642-72874664 GAGGAGGAGAAGAAGGAGGAGGG - Intronic
1192929076 X:75785550-75785572 GAGGAGCAGAAGGTGGAGGAAGG + Intergenic
1193300266 X:79881098-79881120 GCTGGGCTGAAGGGAGAGGAAGG + Intergenic
1193434578 X:81456606-81456628 GAGAGGCTGAAGTGGGAGGATGG + Intergenic
1193824452 X:86205663-86205685 GGGAGGCTGAGGAGGGAGGATGG - Intronic
1194144235 X:90243984-90244006 GCGAAGTTGAAGAGGGAGCAAGG + Intergenic
1195702049 X:107712929-107712951 GCGGAGCAGGAGAGGGAGGAAGG + Intergenic
1195711323 X:107775774-107775796 GCGGACCTGTGGAGGCAGGAAGG + Exonic
1195714121 X:107801766-107801788 CAGGAGCTGAGGTGGGAGGATGG + Intergenic
1195875389 X:109535251-109535273 GGGGAGGGGAAGAGGGAGAAGGG + Intergenic
1195888127 X:109662780-109662802 GGAGAGGTGAAGAGTGAGGAAGG + Intronic
1196302914 X:114066946-114066968 CTGGCGTTGAAGAGGGAGGAAGG + Intergenic
1196398552 X:115290662-115290684 GCAGAGCTGAGTAGAGAGGATGG + Intronic
1196732114 X:118951566-118951588 GGGAGGCTGAAGTGGGAGGATGG - Intergenic
1197723982 X:129763565-129763587 GGGAGGCTGAAGTGGGAGGATGG + Intronic
1198210791 X:134513842-134513864 GAGAAGCTGAGGTGGGAGGATGG - Intronic
1198613270 X:138425497-138425519 GGGGAGCTGAAGGGGATGGATGG - Intergenic
1199824445 X:151484480-151484502 GTGGAGTTGAAGGTGGAGGACGG - Intergenic
1199928853 X:152497348-152497370 GCCAAGCTGAAGATGGAGGTGGG - Intergenic
1200075157 X:153547111-153547133 CCGGGGCAGAAGAGGGAGGTGGG + Intronic
1200489999 Y:3813292-3813314 GCGAAGTTGAAGAGGGAGCAAGG + Intergenic
1201304822 Y:12541548-12541570 GCAGAGGGGAAGCGGGAGGAAGG - Intergenic
1201382097 Y:13392058-13392080 CAGGGGCTGAAGAGGGAGGATGG + Intronic
1201857715 Y:18563909-18563931 GCAGAGGTGCAGAGGAAGGAGGG + Intronic
1201875606 Y:18756472-18756494 GCAGAGGTGCAGAGGAAGGAGGG - Intronic
1201906782 Y:19093557-19093579 CAGGAGCTGGAGATGGAGGAGGG - Intergenic
1202578296 Y:26350879-26350901 GGGGAGGAGAAGAGGGAGTATGG - Intergenic