ID: 948066970

View in Genome Browser
Species Human (GRCh38)
Location 2:235088059-235088081
Sequence CTCCTCCTGCCGGTCCCCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948066959_948066970 13 Left 948066959 2:235088023-235088045 CCTCTCCCACTCCCTGTTCCCGT No data
Right 948066970 2:235088059-235088081 CTCCTCCTGCCGGTCCCCGCCGG No data
948066963_948066970 1 Left 948066963 2:235088035-235088057 CCTGTTCCCGTTCCCATCTCTGT No data
Right 948066970 2:235088059-235088081 CTCCTCCTGCCGGTCCCCGCCGG No data
948066957_948066970 21 Left 948066957 2:235088015-235088037 CCACCTCGCCTCTCCCACTCCCT No data
Right 948066970 2:235088059-235088081 CTCCTCCTGCCGGTCCCCGCCGG No data
948066964_948066970 -5 Left 948066964 2:235088041-235088063 CCCGTTCCCATCTCTGTCCTCCT No data
Right 948066970 2:235088059-235088081 CTCCTCCTGCCGGTCCCCGCCGG No data
948066962_948066970 2 Left 948066962 2:235088034-235088056 CCCTGTTCCCGTTCCCATCTCTG No data
Right 948066970 2:235088059-235088081 CTCCTCCTGCCGGTCCCCGCCGG No data
948066958_948066970 18 Left 948066958 2:235088018-235088040 CCTCGCCTCTCCCACTCCCTGTT No data
Right 948066970 2:235088059-235088081 CTCCTCCTGCCGGTCCCCGCCGG No data
948066961_948066970 7 Left 948066961 2:235088029-235088051 CCACTCCCTGTTCCCGTTCCCAT No data
Right 948066970 2:235088059-235088081 CTCCTCCTGCCGGTCCCCGCCGG No data
948066960_948066970 8 Left 948066960 2:235088028-235088050 CCCACTCCCTGTTCCCGTTCCCA No data
Right 948066970 2:235088059-235088081 CTCCTCCTGCCGGTCCCCGCCGG No data
948066965_948066970 -6 Left 948066965 2:235088042-235088064 CCGTTCCCATCTCTGTCCTCCTC No data
Right 948066970 2:235088059-235088081 CTCCTCCTGCCGGTCCCCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948066970 Original CRISPR CTCCTCCTGCCGGTCCCCGC CGG Intergenic
No off target data available for this crispr