ID: 948068488

View in Genome Browser
Species Human (GRCh38)
Location 2:235100802-235100824
Sequence GTCTCATACAAATGAGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948068488_948068493 18 Left 948068488 2:235100802-235100824 CCTTTCTCTCATTTGTATGAGAC No data
Right 948068493 2:235100843-235100865 TGGAGATTTGGACCTCTAGAAGG No data
948068488_948068489 -2 Left 948068488 2:235100802-235100824 CCTTTCTCTCATTTGTATGAGAC No data
Right 948068489 2:235100823-235100845 ACAGTCAGTGATTTTCACCCTGG No data
948068488_948068490 6 Left 948068488 2:235100802-235100824 CCTTTCTCTCATTTGTATGAGAC No data
Right 948068490 2:235100831-235100853 TGATTTTCACCCTGGAGATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948068488 Original CRISPR GTCTCATACAAATGAGAGAA AGG (reversed) Intergenic
No off target data available for this crispr