ID: 948069423

View in Genome Browser
Species Human (GRCh38)
Location 2:235107563-235107585
Sequence TGTTTTAAATGACAGAAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948069423_948069424 1 Left 948069423 2:235107563-235107585 CCAACTTTCTGTCATTTAAAACA No data
Right 948069424 2:235107587-235107609 CAGCTTTACATATATTGCTCAGG No data
948069423_948069425 2 Left 948069423 2:235107563-235107585 CCAACTTTCTGTCATTTAAAACA No data
Right 948069425 2:235107588-235107610 AGCTTTACATATATTGCTCAGGG No data
948069423_948069426 20 Left 948069423 2:235107563-235107585 CCAACTTTCTGTCATTTAAAACA No data
Right 948069426 2:235107606-235107628 CAGGGTCTGAAATTTGTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948069423 Original CRISPR TGTTTTAAATGACAGAAAGT TGG (reversed) Intergenic
No off target data available for this crispr