ID: 948069426

View in Genome Browser
Species Human (GRCh38)
Location 2:235107606-235107628
Sequence CAGGGTCTGAAATTTGTCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948069423_948069426 20 Left 948069423 2:235107563-235107585 CCAACTTTCTGTCATTTAAAACA No data
Right 948069426 2:235107606-235107628 CAGGGTCTGAAATTTGTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948069426 Original CRISPR CAGGGTCTGAAATTTGTCTC TGG Intergenic
No off target data available for this crispr