ID: 948069882

View in Genome Browser
Species Human (GRCh38)
Location 2:235112061-235112083
Sequence ACAGCATTTCAGGGTGAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948069878_948069882 11 Left 948069878 2:235112027-235112049 CCTGAAGTCATGTTCTCAGCTTC No data
Right 948069882 2:235112061-235112083 ACAGCATTTCAGGGTGAAGCTGG No data
948069876_948069882 18 Left 948069876 2:235112020-235112042 CCTCATCCCTGAAGTCATGTTCT No data
Right 948069882 2:235112061-235112083 ACAGCATTTCAGGGTGAAGCTGG No data
948069877_948069882 12 Left 948069877 2:235112026-235112048 CCCTGAAGTCATGTTCTCAGCTT No data
Right 948069882 2:235112061-235112083 ACAGCATTTCAGGGTGAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948069882 Original CRISPR ACAGCATTTCAGGGTGAAGC TGG Intergenic
No off target data available for this crispr