ID: 948070480

View in Genome Browser
Species Human (GRCh38)
Location 2:235117788-235117810
Sequence CCTGGGGATCAGTTTTACAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948070472_948070480 30 Left 948070472 2:235117735-235117757 CCTCGCTTGAAACTTAGTGGGCA No data
Right 948070480 2:235117788-235117810 CCTGGGGATCAGTTTTACATGGG No data
948070474_948070480 6 Left 948070474 2:235117759-235117781 CCACTAACGACTAAGGAATAGAT No data
Right 948070480 2:235117788-235117810 CCTGGGGATCAGTTTTACATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948070480 Original CRISPR CCTGGGGATCAGTTTTACAT GGG Intergenic
No off target data available for this crispr