ID: 948071970

View in Genome Browser
Species Human (GRCh38)
Location 2:235135166-235135188
Sequence CTGTCCAAGGGTGAATTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948071970_948071975 -1 Left 948071970 2:235135166-235135188 CCTTCCAATTCACCCTTGGACAG No data
Right 948071975 2:235135188-235135210 GGCCCCTTCCAGTTCACCCTCGG No data
948071970_948071982 26 Left 948071970 2:235135166-235135188 CCTTCCAATTCACCCTTGGACAG No data
Right 948071982 2:235135215-235135237 GCCTCCTTTCAATTAACACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948071970 Original CRISPR CTGTCCAAGGGTGAATTGGA AGG (reversed) Intergenic
No off target data available for this crispr