ID: 948071975

View in Genome Browser
Species Human (GRCh38)
Location 2:235135188-235135210
Sequence GGCCCCTTCCAGTTCACCCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948071972_948071975 -5 Left 948071972 2:235135170-235135192 CCAATTCACCCTTGGACAGGCCC No data
Right 948071975 2:235135188-235135210 GGCCCCTTCCAGTTCACCCTCGG No data
948071969_948071975 0 Left 948071969 2:235135165-235135187 CCCTTCCAATTCACCCTTGGACA No data
Right 948071975 2:235135188-235135210 GGCCCCTTCCAGTTCACCCTCGG No data
948071968_948071975 1 Left 948071968 2:235135164-235135186 CCCCTTCCAATTCACCCTTGGAC No data
Right 948071975 2:235135188-235135210 GGCCCCTTCCAGTTCACCCTCGG No data
948071970_948071975 -1 Left 948071970 2:235135166-235135188 CCTTCCAATTCACCCTTGGACAG No data
Right 948071975 2:235135188-235135210 GGCCCCTTCCAGTTCACCCTCGG No data
948071962_948071975 25 Left 948071962 2:235135140-235135162 CCTTCCAGTTCACCCTCAGACAG No data
Right 948071975 2:235135188-235135210 GGCCCCTTCCAGTTCACCCTCGG No data
948071966_948071975 12 Left 948071966 2:235135153-235135175 CCTCAGACAGGCCCCTTCCAATT No data
Right 948071975 2:235135188-235135210 GGCCCCTTCCAGTTCACCCTCGG No data
948071965_948071975 13 Left 948071965 2:235135152-235135174 CCCTCAGACAGGCCCCTTCCAAT No data
Right 948071975 2:235135188-235135210 GGCCCCTTCCAGTTCACCCTCGG No data
948071964_948071975 21 Left 948071964 2:235135144-235135166 CCAGTTCACCCTCAGACAGGCCC No data
Right 948071975 2:235135188-235135210 GGCCCCTTCCAGTTCACCCTCGG No data
948071961_948071975 26 Left 948071961 2:235135139-235135161 CCCTTCCAGTTCACCCTCAGACA No data
Right 948071975 2:235135188-235135210 GGCCCCTTCCAGTTCACCCTCGG No data
948071960_948071975 27 Left 948071960 2:235135138-235135160 CCCCTTCCAGTTCACCCTCAGAC No data
Right 948071975 2:235135188-235135210 GGCCCCTTCCAGTTCACCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948071975 Original CRISPR GGCCCCTTCCAGTTCACCCT CGG Intergenic
No off target data available for this crispr