ID: 948071982

View in Genome Browser
Species Human (GRCh38)
Location 2:235135215-235135237
Sequence GCCTCCTTTCAATTAACACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948071972_948071982 22 Left 948071972 2:235135170-235135192 CCAATTCACCCTTGGACAGGCCC No data
Right 948071982 2:235135215-235135237 GCCTCCTTTCAATTAACACTTGG No data
948071968_948071982 28 Left 948071968 2:235135164-235135186 CCCCTTCCAATTCACCCTTGGAC No data
Right 948071982 2:235135215-235135237 GCCTCCTTTCAATTAACACTTGG No data
948071976_948071982 2 Left 948071976 2:235135190-235135212 CCCCTTCCAGTTCACCCTCGGAC No data
Right 948071982 2:235135215-235135237 GCCTCCTTTCAATTAACACTTGG No data
948071970_948071982 26 Left 948071970 2:235135166-235135188 CCTTCCAATTCACCCTTGGACAG No data
Right 948071982 2:235135215-235135237 GCCTCCTTTCAATTAACACTTGG No data
948071979_948071982 -4 Left 948071979 2:235135196-235135218 CCAGTTCACCCTCGGACAAGCCT No data
Right 948071982 2:235135215-235135237 GCCTCCTTTCAATTAACACTTGG No data
948071969_948071982 27 Left 948071969 2:235135165-235135187 CCCTTCCAATTCACCCTTGGACA No data
Right 948071982 2:235135215-235135237 GCCTCCTTTCAATTAACACTTGG No data
948071974_948071982 13 Left 948071974 2:235135179-235135201 CCTTGGACAGGCCCCTTCCAGTT No data
Right 948071982 2:235135215-235135237 GCCTCCTTTCAATTAACACTTGG No data
948071973_948071982 14 Left 948071973 2:235135178-235135200 CCCTTGGACAGGCCCCTTCCAGT No data
Right 948071982 2:235135215-235135237 GCCTCCTTTCAATTAACACTTGG No data
948071977_948071982 1 Left 948071977 2:235135191-235135213 CCCTTCCAGTTCACCCTCGGACA No data
Right 948071982 2:235135215-235135237 GCCTCCTTTCAATTAACACTTGG No data
948071978_948071982 0 Left 948071978 2:235135192-235135214 CCTTCCAGTTCACCCTCGGACAA No data
Right 948071982 2:235135215-235135237 GCCTCCTTTCAATTAACACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948071982 Original CRISPR GCCTCCTTTCAATTAACACT TGG Intergenic
No off target data available for this crispr