ID: 948075229

View in Genome Browser
Species Human (GRCh38)
Location 2:235160688-235160710
Sequence CCTTATAGGAGGAGGGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948075229_948075237 19 Left 948075229 2:235160688-235160710 CCTGCCTCCCTCCTCCTATAAGG No data
Right 948075237 2:235160730-235160752 GAACCCACCAGGATAATCTACGG No data
948075229_948075236 8 Left 948075229 2:235160688-235160710 CCTGCCTCCCTCCTCCTATAAGG No data
Right 948075236 2:235160719-235160741 GATTGCATTTAGAACCCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948075229 Original CRISPR CCTTATAGGAGGAGGGAGGC AGG (reversed) Intergenic
No off target data available for this crispr