ID: 948078393

View in Genome Browser
Species Human (GRCh38)
Location 2:235185130-235185152
Sequence CAGTTTTGCCAGAGGGGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948078393_948078397 -5 Left 948078393 2:235185130-235185152 CCTTCTCCCCTCTGGCAAAACTG No data
Right 948078397 2:235185148-235185170 AACTGCACTTAAATGAGACTAGG No data
948078393_948078398 -2 Left 948078393 2:235185130-235185152 CCTTCTCCCCTCTGGCAAAACTG No data
Right 948078398 2:235185151-235185173 TGCACTTAAATGAGACTAGGAGG No data
948078393_948078399 22 Left 948078393 2:235185130-235185152 CCTTCTCCCCTCTGGCAAAACTG No data
Right 948078399 2:235185175-235185197 AAGTTGTCTGTTCATTCTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948078393 Original CRISPR CAGTTTTGCCAGAGGGGAGA AGG (reversed) Intergenic
No off target data available for this crispr