ID: 948079660

View in Genome Browser
Species Human (GRCh38)
Location 2:235195484-235195506
Sequence AGTCTCCCCCTGCCACGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948079655_948079660 6 Left 948079655 2:235195455-235195477 CCTGCATTCCCTCATGCTTAACA No data
Right 948079660 2:235195484-235195506 AGTCTCCCCCTGCCACGGAAGGG No data
948079653_948079660 12 Left 948079653 2:235195449-235195471 CCTCCACCTGCATTCCCTCATGC No data
Right 948079660 2:235195484-235195506 AGTCTCCCCCTGCCACGGAAGGG No data
948079656_948079660 -2 Left 948079656 2:235195463-235195485 CCCTCATGCTTAACACAAAAGAG No data
Right 948079660 2:235195484-235195506 AGTCTCCCCCTGCCACGGAAGGG No data
948079657_948079660 -3 Left 948079657 2:235195464-235195486 CCTCATGCTTAACACAAAAGAGT No data
Right 948079660 2:235195484-235195506 AGTCTCCCCCTGCCACGGAAGGG No data
948079654_948079660 9 Left 948079654 2:235195452-235195474 CCACCTGCATTCCCTCATGCTTA No data
Right 948079660 2:235195484-235195506 AGTCTCCCCCTGCCACGGAAGGG No data
948079652_948079660 18 Left 948079652 2:235195443-235195465 CCAGCTCCTCCACCTGCATTCCC No data
Right 948079660 2:235195484-235195506 AGTCTCCCCCTGCCACGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948079660 Original CRISPR AGTCTCCCCCTGCCACGGAA GGG Intergenic
No off target data available for this crispr