ID: 948080660

View in Genome Browser
Species Human (GRCh38)
Location 2:235202784-235202806
Sequence CATGCTGAGCACAGGGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948080660_948080670 14 Left 948080660 2:235202784-235202806 CCTGCTTCCCTGTGCTCAGCATG No data
Right 948080670 2:235202821-235202843 CACCAGCCTTCTGGAAGCCCTGG No data
948080660_948080666 5 Left 948080660 2:235202784-235202806 CCTGCTTCCCTGTGCTCAGCATG No data
Right 948080666 2:235202812-235202834 CTCGGACCCCACCAGCCTTCTGG No data
948080660_948080671 15 Left 948080660 2:235202784-235202806 CCTGCTTCCCTGTGCTCAGCATG No data
Right 948080671 2:235202822-235202844 ACCAGCCTTCTGGAAGCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948080660 Original CRISPR CATGCTGAGCACAGGGAAGC AGG (reversed) Intergenic
No off target data available for this crispr