ID: 948084004

View in Genome Browser
Species Human (GRCh38)
Location 2:235231281-235231303
Sequence CTAAAGATTCAGATGGCCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948084004_948084010 8 Left 948084004 2:235231281-235231303 CCCTTGGCCATCTGAATCTTTAG No data
Right 948084010 2:235231312-235231334 GAGCATTGACAAACATGGTGGGG No data
948084004_948084008 6 Left 948084004 2:235231281-235231303 CCCTTGGCCATCTGAATCTTTAG No data
Right 948084008 2:235231310-235231332 TTGAGCATTGACAAACATGGTGG No data
948084004_948084007 3 Left 948084004 2:235231281-235231303 CCCTTGGCCATCTGAATCTTTAG No data
Right 948084007 2:235231307-235231329 TACTTGAGCATTGACAAACATGG No data
948084004_948084011 21 Left 948084004 2:235231281-235231303 CCCTTGGCCATCTGAATCTTTAG No data
Right 948084011 2:235231325-235231347 CATGGTGGGGACTCTCTCAAAGG No data
948084004_948084009 7 Left 948084004 2:235231281-235231303 CCCTTGGCCATCTGAATCTTTAG No data
Right 948084009 2:235231311-235231333 TGAGCATTGACAAACATGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948084004 Original CRISPR CTAAAGATTCAGATGGCCAA GGG (reversed) Intergenic
No off target data available for this crispr