ID: 948084136

View in Genome Browser
Species Human (GRCh38)
Location 2:235232383-235232405
Sequence TCTACAGGGTGCAGGCAGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948084126_948084136 25 Left 948084126 2:235232335-235232357 CCTACATATTTTAGAGCACTCTG No data
Right 948084136 2:235232383-235232405 TCTACAGGGTGCAGGCAGCCGGG No data
948084123_948084136 28 Left 948084123 2:235232332-235232354 CCCCCTACATATTTTAGAGCACT No data
Right 948084136 2:235232383-235232405 TCTACAGGGTGCAGGCAGCCGGG No data
948084124_948084136 27 Left 948084124 2:235232333-235232355 CCCCTACATATTTTAGAGCACTC No data
Right 948084136 2:235232383-235232405 TCTACAGGGTGCAGGCAGCCGGG No data
948084125_948084136 26 Left 948084125 2:235232334-235232356 CCCTACATATTTTAGAGCACTCT No data
Right 948084136 2:235232383-235232405 TCTACAGGGTGCAGGCAGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948084136 Original CRISPR TCTACAGGGTGCAGGCAGCC GGG Intergenic