ID: 948084183

View in Genome Browser
Species Human (GRCh38)
Location 2:235232682-235232704
Sequence GTGACAACATTGTCATCTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948084183_948084187 6 Left 948084183 2:235232682-235232704 CCATGAGATGACAATGTTGTCAC No data
Right 948084187 2:235232711-235232733 GCCCGCCTCAGATCTAGCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948084183 Original CRISPR GTGACAACATTGTCATCTCA TGG (reversed) Intergenic
No off target data available for this crispr