ID: 948084346

View in Genome Browser
Species Human (GRCh38)
Location 2:235234240-235234262
Sequence TGTGCACTAGGGCACTATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948084341_948084346 22 Left 948084341 2:235234195-235234217 CCTTGTTATTTTGTATAGAATTC No data
Right 948084346 2:235234240-235234262 TGTGCACTAGGGCACTATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948084346 Original CRISPR TGTGCACTAGGGCACTATGG TGG Intergenic
No off target data available for this crispr