ID: 948087469

View in Genome Browser
Species Human (GRCh38)
Location 2:235263529-235263551
Sequence GTAAAGGAGAGGAGGACTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948087469_948087474 -10 Left 948087469 2:235263529-235263551 CCCATAGTCCTCCTCTCCTTTAC No data
Right 948087474 2:235263542-235263564 TCTCCTTTACCCGCTAACATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948087469 Original CRISPR GTAAAGGAGAGGAGGACTAT GGG (reversed) Intergenic
No off target data available for this crispr