ID: 948087714

View in Genome Browser
Species Human (GRCh38)
Location 2:235265480-235265502
Sequence CAGGGTGAAGACAGGGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948087714_948087725 24 Left 948087714 2:235265480-235265502 CCAGCCTCCCTGTCTTCACCCTG No data
Right 948087725 2:235265527-235265549 GCTTGGCCAGCTGGAGGCCCTGG No data
948087714_948087726 28 Left 948087714 2:235265480-235265502 CCAGCCTCCCTGTCTTCACCCTG No data
Right 948087726 2:235265531-235265553 GGCCAGCTGGAGGCCCTGGCAGG No data
948087714_948087722 7 Left 948087714 2:235265480-235265502 CCAGCCTCCCTGTCTTCACCCTG No data
Right 948087722 2:235265510-235265532 TTCAGCAGACAGCGTGGGCTTGG No data
948087714_948087721 2 Left 948087714 2:235265480-235265502 CCAGCCTCCCTGTCTTCACCCTG No data
Right 948087721 2:235265505-235265527 TCTGCTTCAGCAGACAGCGTGGG No data
948087714_948087720 1 Left 948087714 2:235265480-235265502 CCAGCCTCCCTGTCTTCACCCTG No data
Right 948087720 2:235265504-235265526 GTCTGCTTCAGCAGACAGCGTGG No data
948087714_948087723 15 Left 948087714 2:235265480-235265502 CCAGCCTCCCTGTCTTCACCCTG No data
Right 948087723 2:235265518-235265540 ACAGCGTGGGCTTGGCCAGCTGG No data
948087714_948087724 18 Left 948087714 2:235265480-235265502 CCAGCCTCCCTGTCTTCACCCTG No data
Right 948087724 2:235265521-235265543 GCGTGGGCTTGGCCAGCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948087714 Original CRISPR CAGGGTGAAGACAGGGAGGC TGG (reversed) Intergenic
No off target data available for this crispr