ID: 948090392

View in Genome Browser
Species Human (GRCh38)
Location 2:235288734-235288756
Sequence CAGAATTAGGAGATTGGGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948090392_948090399 16 Left 948090392 2:235288734-235288756 CCGGCCCCAATCTCCTAATTCTG No data
Right 948090399 2:235288773-235288795 CCAGCTAGCACACTGCTACCAGG No data
948090392_948090401 20 Left 948090392 2:235288734-235288756 CCGGCCCCAATCTCCTAATTCTG No data
Right 948090401 2:235288777-235288799 CTAGCACACTGCTACCAGGAGGG No data
948090392_948090400 19 Left 948090392 2:235288734-235288756 CCGGCCCCAATCTCCTAATTCTG No data
Right 948090400 2:235288776-235288798 GCTAGCACACTGCTACCAGGAGG No data
948090392_948090402 27 Left 948090392 2:235288734-235288756 CCGGCCCCAATCTCCTAATTCTG No data
Right 948090402 2:235288784-235288806 ACTGCTACCAGGAGGGTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948090392 Original CRISPR CAGAATTAGGAGATTGGGGC CGG (reversed) Intergenic
No off target data available for this crispr