ID: 948093498

View in Genome Browser
Species Human (GRCh38)
Location 2:235315171-235315193
Sequence TGGCACAATCGCTTGAGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948093489_948093498 10 Left 948093489 2:235315138-235315160 CCCCTGTAATCCCAACATTTCGG No data
Right 948093498 2:235315171-235315193 TGGCACAATCGCTTGAGCCCAGG No data
948093485_948093498 28 Left 948093485 2:235315120-235315142 CCCAGGCCCTGTGGCTCACCCCT No data
Right 948093498 2:235315171-235315193 TGGCACAATCGCTTGAGCCCAGG No data
948093488_948093498 21 Left 948093488 2:235315127-235315149 CCTGTGGCTCACCCCTGTAATCC 0: 32
1: 2019
2: 2850
3: 2402
4: 1534
Right 948093498 2:235315171-235315193 TGGCACAATCGCTTGAGCCCAGG No data
948093493_948093498 8 Left 948093493 2:235315140-235315162 CCTGTAATCCCAACATTTCGGGT No data
Right 948093498 2:235315171-235315193 TGGCACAATCGCTTGAGCCCAGG No data
948093496_948093498 -1 Left 948093496 2:235315149-235315171 CCAACATTTCGGGTGGCTGAGAT No data
Right 948093498 2:235315171-235315193 TGGCACAATCGCTTGAGCCCAGG No data
948093486_948093498 27 Left 948093486 2:235315121-235315143 CCAGGCCCTGTGGCTCACCCCTG No data
Right 948093498 2:235315171-235315193 TGGCACAATCGCTTGAGCCCAGG No data
948093491_948093498 9 Left 948093491 2:235315139-235315161 CCCTGTAATCCCAACATTTCGGG No data
Right 948093498 2:235315171-235315193 TGGCACAATCGCTTGAGCCCAGG No data
948093495_948093498 0 Left 948093495 2:235315148-235315170 CCCAACATTTCGGGTGGCTGAGA No data
Right 948093498 2:235315171-235315193 TGGCACAATCGCTTGAGCCCAGG No data
948093487_948093498 22 Left 948093487 2:235315126-235315148 CCCTGTGGCTCACCCCTGTAATC No data
Right 948093498 2:235315171-235315193 TGGCACAATCGCTTGAGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948093498 Original CRISPR TGGCACAATCGCTTGAGCCC AGG Intergenic
No off target data available for this crispr