ID: 948095331

View in Genome Browser
Species Human (GRCh38)
Location 2:235328970-235328992
Sequence GAGAAGAGTCAAAGAATTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948095331_948095334 -10 Left 948095331 2:235328970-235328992 CCACAAATTCTTTGACTCTTCTC No data
Right 948095334 2:235328983-235329005 GACTCTTCTCCATTGAGAAGGGG No data
948095331_948095338 1 Left 948095331 2:235328970-235328992 CCACAAATTCTTTGACTCTTCTC No data
Right 948095338 2:235328994-235329016 ATTGAGAAGGGGATTGAGGAGGG No data
948095331_948095339 2 Left 948095331 2:235328970-235328992 CCACAAATTCTTTGACTCTTCTC No data
Right 948095339 2:235328995-235329017 TTGAGAAGGGGATTGAGGAGGGG No data
948095331_948095340 22 Left 948095331 2:235328970-235328992 CCACAAATTCTTTGACTCTTCTC No data
Right 948095340 2:235329015-235329037 GGGCTCCATGTCCTCTCCCTTGG No data
948095331_948095337 0 Left 948095331 2:235328970-235328992 CCACAAATTCTTTGACTCTTCTC No data
Right 948095337 2:235328993-235329015 CATTGAGAAGGGGATTGAGGAGG No data
948095331_948095335 -3 Left 948095331 2:235328970-235328992 CCACAAATTCTTTGACTCTTCTC No data
Right 948095335 2:235328990-235329012 CTCCATTGAGAAGGGGATTGAGG No data
948095331_948095342 29 Left 948095331 2:235328970-235328992 CCACAAATTCTTTGACTCTTCTC No data
Right 948095342 2:235329022-235329044 ATGTCCTCTCCCTTGGTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948095331 Original CRISPR GAGAAGAGTCAAAGAATTTG TGG (reversed) Intergenic
No off target data available for this crispr